pycom08g14130

Sister chromatid cohesion protein PDS5 homolog

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr8
OG0029351
Physical Location & Seq
Reverse (-)
13189184 .. 13189498
315 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 237 bp
ATGTTTCGGGCTATGGCACCCGAACCTCCTTTCGCCGACAAATATCTAAGGAACATTTTAAAACTCATTATCAGCATGTTCGTGAAGCTAGCTGACATGGAAAGCCCGCTCTTCTCGAGGAGGGCTAAAATAGTAGAGACTGTTGCACGATGTAAATGTTGTGTGATCATGTTGGATATTAACTGCAATGATCTAGATCTCGAAATGTTCAATATATTCTTCTCTGTTGTGAGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

79

Amino Acids

9.09

Weight (kDa)

8.44

Isoelectric Point (pI)

48.85

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PDS5 PF20168 1 - 77 2.5e-22 Sister chromatid cohesion protein PDS5 protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0029351)

Species Orthologous Gene IDs
pyrus_communis pycom08g14130
rosa_multiflora Rmu_sc0018345.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 16
AccBSI CCGCTC 1 cut(s) 109
AciI CCGC 1 cut(s) 107
AgsI TTSAA 1 cut(s) 211
AluBI AGCT 2 cut(s) 88, 92
AluI AGCT 2 cut(s) 88, 92
Alw26I GTCTC 1 cut(s) 131
Ama87I CYCGRG 1 cut(s) 115
AsuNHI GCTAGC 1 cut(s) 88
AvaI CYCGRG 1 cut(s) 115
BanI GGYRCC 1 cut(s) 16
BclI TGATCA 1 cut(s) 165
BcoDI GTCTC 1 cut(s) 131
BfaI CTAG 2 cut(s) 89, 194
BglII AGATCT 1 cut(s) 196
BmeT110I CYCGRG 1 cut(s) 115
BmiI GGNNCC 1 cut(s) 18
BmtI GCTAGC 1 cut(s) 92
BsaBI GATNNNNATC 1 cut(s) 195
Bse3DI GCAATG 1 cut(s) 193
Bse8I GATNNNNATC 1 cut(s) 195
BseJI GATNNNNATC 1 cut(s) 195
BseMI GCAATG 1 cut(s) 193
BseRI GAGGAG 1 cut(s) 133
BshNI GGYRCC 1 cut(s) 16
BsiHKCI CYCGRG 1 cut(s) 115
BsmAI GTCTC 1 cut(s) 131
BsoBI CYCGRG 1 cut(s) 115
Bsp143I GATC 3 cut(s) 165, 190, 196
BspACI CCGC 1 cut(s) 107
BspLI GGNNCC 1 cut(s) 18
BspOI GCTAGC 1 cut(s) 92
BspQI GCTCTTC 1 cut(s) 116
BspT107I GGYRCC 1 cut(s) 16
BsrBI CCGCTC 1 cut(s) 109
BsrDI GCAATG 1 cut(s) 193
BssMI GATC 3 cut(s) 165, 190, 196
Bst4CI ACNGT 1 cut(s) 142
Bst6I CTCTTC 1 cut(s) 116
BstC8I GCNNGC 2 cut(s) 90, 107
BstDEI CTNAG 1 cut(s) 47
BstKTI GATC 3 cut(s) 168, 193, 199
BstMAI GTCTC 1 cut(s) 131
BstMBI GATC 3 cut(s) 165, 190, 196
BstNSI RCATGY 1 cut(s) 79
BstX2I RGATCY 1 cut(s) 196
BstYI RGATCY 1 cut(s) 196
Cac8I GCNNGC 2 cut(s) 90, 107
CviAII CATG 3 cut(s) 76, 97, 169
CviJI RGCY 5 cut(s) 11, 88, 92, 105, 125
CviKI_1 RGCY 5 cut(s) 11, 88, 92, 105, 125
DdeI CTNAG 1 cut(s) 47
DpnI GATC 3 cut(s) 167, 192, 198
DpnII GATC 3 cut(s) 165, 190, 196
DraI TTTAAA 1 cut(s) 60
Eam1104I CTCTTC 1 cut(s) 116
EarI CTCTTC 1 cut(s) 116
Eco88I CYCGRG 1 cut(s) 115
FaeI CATG 3 cut(s) 79, 100, 172
FaiI YATR 5 cut(s) 14, 77, 98, 170, 215
FatI CATG 3 cut(s) 75, 96, 168
FauI CCCGC 1 cut(s) 114
FbaI TGATCA 1 cut(s) 165
FspBI CTAG 2 cut(s) 89, 194
Hin1II CATG 3 cut(s) 79, 100, 172
Hpy188III TCNNGA 4 cut(s) 82, 115, 194, 200
HpyCH4III ACNGT 1 cut(s) 142
HpyCH4V TGCA 2 cut(s) 146, 186
HpyF3I CTNAG 1 cut(s) 47
Hsp92II CATG 3 cut(s) 79, 100, 172
Ksp22I TGATCA 1 cut(s) 165
Kzo9I GATC 3 cut(s) 165, 190, 196
LguI GCTCTTC 1 cut(s) 116
MaeI CTAG 2 cut(s) 89, 194
MalI GATC 3 cut(s) 167, 192, 198
MbiI CCGCTC 1 cut(s) 109
MboI GATC 3 cut(s) 165, 190, 196
MboII GAAGA 2 cut(s) 103, 211
MflI RGATCY 1 cut(s) 196
MmeI TCCRAC 1 cut(s) 153
MnlI CCTC 4 cut(s) 36, 111, 114, 225
MseI TTAA 2 cut(s) 59, 180
MslI CAYNNNNRTG 1 cut(s) 80
NdeII GATC 3 cut(s) 165, 190, 196
NheI GCTAGC 1 cut(s) 88
NlaIII CATG 3 cut(s) 79, 100, 172
NlaIV GGNNCC 1 cut(s) 18
NspI RCATGY 1 cut(s) 79
PaeR7I CTCGAG 1 cut(s) 115
PciSI GCTCTTC 1 cut(s) 116
PspN4I GGNNCC 1 cut(s) 18
PsuI RGATCY 1 cut(s) 196
RseI CAYNNNNRTG 1 cut(s) 80
SapI GCTCTTC 1 cut(s) 116
SaqAI TTAA 2 cut(s) 59, 180
Sau3AI GATC 3 cut(s) 165, 190, 196
SetI ASST 4 cut(s) 28, 90, 94, 236
Sfr274I CTCGAG 1 cut(s) 115
SlaI CTCGAG 1 cut(s) 115
SmiMI CAYNNNNRTG 1 cut(s) 80
SmlI CTYRAG 1 cut(s) 115
SmoI CTYRAG 1 cut(s) 115
SsiI CCGC 1 cut(s) 107
SspMI CTAG 2 cut(s) 89, 194
TaaI ACNGT 1 cut(s) 142
TaqI TCGA 2 cut(s) 116, 201
Tru1I TTAA 2 cut(s) 59, 180
Tru9I TTAA 2 cut(s) 59, 180
XbaI TCTAGA 1 cut(s) 193
XceI RCATGY 1 cut(s) 79
XhoI CTCGAG 1 cut(s) 115
XspI CTAG 2 cut(s) 89, 194
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.