pycom10g00280

Peptide chain release factor

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr10
Physical Location & Seq
Forward (+)
375254 .. 375694
441 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom10g00280.3

Sequence Viewer

Length: 294 bp
ATGAACAAAGCCAAGGCAATTAAGGTGTTGTGTGCAAAGCCTTATGAGATAGAGAGGTCTAGACCTCACGCCAATCGAACAAGACTCCGATCTCAACAGATTGGTAGTAGGGATACATCTGAACGCATCCGTACATACACTTTTTTCCAAGGACGTGTAACTGATCACCGTGTTGGAATCACACATCATTCGATAAATGATGTGATGCAGGGAAAGAATCTGGATGTATTTATTGATGCCCTTCCTTTGCAAGAAGAAATGGATGCAATTGCTTCTTTCAGTTGTTCGCAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

98

Amino Acids

11.13

Weight (kDa)

9.44

Isoelectric Point (pI)

49.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029373)

Species Orthologous Gene IDs
pyrus_communis pycom10g00280
rosa_roxburghii Rroxscaffold_2G00118230

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 133
AflIII ACRYGT 1 cut(s) 154
AjiI CACGTC 1 cut(s) 155
AsuHPI GGTGA 1 cut(s) 158
BciVI GTATCC 1 cut(s) 106
BclI TGATCA 1 cut(s) 163
BfaI CTAG 1 cut(s) 60
BfuI GTATCC 1 cut(s) 106
BmgBI CACGTC 1 cut(s) 155
BmsI GCATC 4 cut(s) 135, 195, 226, 253
BsaJI CCNNGG 2 cut(s) 12, 148
BseDI CCNNGG 2 cut(s) 12, 148
BseGI GGATG 3 cut(s) 126, 229, 268
Bsp143I GATC 2 cut(s) 89, 163
BssECI CCNNGG 2 cut(s) 12, 148
BssMI GATC 2 cut(s) 89, 163
BssT1I CCWWGG 2 cut(s) 12, 148
Bst4CI ACNGT 1 cut(s) 170
BstF5I GGATG 3 cut(s) 126, 229, 268
BstKTI GATC 2 cut(s) 92, 166
BstMBI GATC 2 cut(s) 89, 163
BsuI GTATCC 1 cut(s) 106
BtrI CACGTC 1 cut(s) 155
BtsCI GGATG 3 cut(s) 126, 229, 268
Csp6I GTAC 1 cut(s) 132
CviJI RGCY 2 cut(s) 11, 40
CviKI_1 RGCY 2 cut(s) 11, 40
CviQI GTAC 1 cut(s) 132
DpnI GATC 2 cut(s) 91, 165
DpnII GATC 2 cut(s) 89, 163
Eco130I CCWWGG 2 cut(s) 12, 148
EcoT14I CCWWGG 2 cut(s) 12, 148
ErhI CCWWGG 2 cut(s) 12, 148
FaiI YATR 2 cut(s) 45, 136
FbaI TGATCA 1 cut(s) 163
FokI GGATG 3 cut(s) 113, 236, 275
FspBI CTAG 1 cut(s) 60
HinfI GANTC 3 cut(s) 84, 177, 217
HphI GGTGA 1 cut(s) 158
Hpy188I TCNGA 2 cut(s) 89, 121
Hpy188III TCNNGA 2 cut(s) 60, 221
HpyAV CCTTC 1 cut(s) 251
HpyCH4III ACNGT 1 cut(s) 170
HpyCH4IV ACGT 1 cut(s) 154
HpyCH4V TGCA 4 cut(s) 35, 208, 250, 266
HpySE526I ACGT 1 cut(s) 154
Ksp22I TGATCA 1 cut(s) 163
Kzo9I GATC 2 cut(s) 89, 163
LpnPI CCDG 2 cut(s) 194, 206
LweI GCATC 4 cut(s) 135, 195, 226, 253
MaeI CTAG 1 cut(s) 60
MaeII ACGT 1 cut(s) 154
MaeIII GTNAC 1 cut(s) 157
MalI GATC 2 cut(s) 91, 165
MboI GATC 2 cut(s) 89, 163
MboII GAAGA 1 cut(s) 266
MfeI CAATTG 1 cut(s) 267
MluCI AATT 2 cut(s) 18, 267
MlyI GAGTC 1 cut(s) 78
MmeI TCCRAC 1 cut(s) 154
MnlI CCTC 2 cut(s) 48, 75
MseI TTAA 1 cut(s) 21
MunI CAATTG 1 cut(s) 267
NdeII GATC 2 cut(s) 89, 163
PfeI GAWTC 2 cut(s) 177, 217
PleI GAGTC 1 cut(s) 78
PpsI GAGTC 1 cut(s) 78
RsaI GTAC 1 cut(s) 133
RsaNI GTAC 1 cut(s) 132
SaqAI TTAA 1 cut(s) 21
Sau3AI GATC 2 cut(s) 89, 163
SchI GAGTC 1 cut(s) 78
SetI ASST 4 cut(s) 27, 59, 67, 157
SfaNI GCATC 4 cut(s) 135, 195, 226, 253
Sse9I AATT 2 cut(s) 18, 267
SspMI CTAG 1 cut(s) 60
StyI CCWWGG 2 cut(s) 12, 148
TaaI ACNGT 1 cut(s) 170
TaiI ACGT 1 cut(s) 157
TaqI TCGA 2 cut(s) 76, 191
TasI AATT 2 cut(s) 18, 267
TfiI GAWTC 2 cut(s) 177, 217
Tru1I TTAA 1 cut(s) 21
Tru9I TTAA 1 cut(s) 21
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 119
XbaI TCTAGA 1 cut(s) 59
XspI CTAG 1 cut(s) 60
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.