pycom10g20450

membrane

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr10
Physical Location & Seq
Forward (+)
23336736 .. 23337014
279 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom10g20450.1

Sequence Viewer

Length: 189 bp
ATGTTTTTTGAAATAACATTGCTTAAAAAAGCGGTTTTAATCCGAACTCAATTCTTTTCGGGGACATATTCTAGGTTGATTCACATTCTGGGATGTAATATAGTTGGCGTGTTGGGCCCCTATATGCTGCTTAAAGGCTGGTATCGACTGATTCATCGATCTGATTACTCGAGTAGGTCCATTTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

7.21

Weight (kDa)

10.13

Isoelectric Point (pI)

53.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024311)

Species Orthologous Gene IDs
malus_domestica MD09G1174800.v1.1
pyrus_communis pycom10g20450 pycom11g14100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 32
AgsI TTSAA 1 cut(s) 11
Ama87I CYCGRG 1 cut(s) 169
AoxI GGCC 1 cut(s) 115
ApaI GGGCCC 1 cut(s) 119
ApeKI GCWGC 1 cut(s) 127
AspS9I GGNCC 3 cut(s) 115, 116, 177
AvaI CYCGRG 1 cut(s) 169
AvaII GGWCC 1 cut(s) 177
BaeGI GKGCMC 1 cut(s) 119
BanII GRGCYC 1 cut(s) 119
BbvI GCAGC 1 cut(s) 114
BfaI CTAG 1 cut(s) 72
BisI GCNGC 1 cut(s) 128
BlsI GCNGC 1 cut(s) 129
Bme18I GGWCC 1 cut(s) 177
BmeT110I CYCGRG 1 cut(s) 169
BmgT120I GGNCC 3 cut(s) 115, 116, 177
BmiI GGNNCC 2 cut(s) 117, 118
Bsa29I ATCGAT 1 cut(s) 157
Bse3DI GCAATG 1 cut(s) 17
BseCI ATCGAT 1 cut(s) 157
BseGI GGATG 1 cut(s) 98
BseMI GCAATG 1 cut(s) 17
BseSI GKGCMC 1 cut(s) 119
BseXI GCAGC 1 cut(s) 114
BshFI GGCC 1 cut(s) 117
BshVI ATCGAT 1 cut(s) 157
BsiHKCI CYCGRG 1 cut(s) 169
BslFI GGGAC 1 cut(s) 76
BsmFI GGGAC 1 cut(s) 76
BsnI GGCC 1 cut(s) 117
BsoBI CYCGRG 1 cut(s) 169
Bsp120I GGGCCC 1 cut(s) 115
Bsp1286I GDGCHC 1 cut(s) 119
Bsp143I GATC 1 cut(s) 158
BspACI CCGC 1 cut(s) 32
BspANI GGCC 1 cut(s) 117
BspDI ATCGAT 1 cut(s) 157
BspLI GGNNCC 2 cut(s) 117, 118
BsrDI GCAATG 1 cut(s) 17
BssMI GATC 1 cut(s) 158
BstF5I GGATG 1 cut(s) 98
BstKTI GATC 1 cut(s) 161
BstMBI GATC 1 cut(s) 158
BstMWI GCNNNNNNNGC 1 cut(s) 114
BstSLI GKGCMC 1 cut(s) 119
BstV1I GCAGC 1 cut(s) 114
Bsu15I ATCGAT 1 cut(s) 157
BsuRI GGCC 1 cut(s) 117
BsuTUI ATCGAT 1 cut(s) 157
BtsCI GGATG 1 cut(s) 98
Cfr13I GGNCC 3 cut(s) 115, 116, 177
ClaI ATCGAT 1 cut(s) 157
CviJI RGCY 2 cut(s) 117, 138
CviKI_1 RGCY 2 cut(s) 117, 138
DpnI GATC 1 cut(s) 160
DpnII GATC 1 cut(s) 158
Eco24I GRGCYC 1 cut(s) 119
Eco47I GGWCC 1 cut(s) 177
Eco88I CYCGRG 1 cut(s) 169
EcoO109I RGGNCCY 1 cut(s) 116
EcoT38I GRGCYC 1 cut(s) 119
FaiI YATR 4 cut(s) 67, 101, 123, 125
FaqI GGGAC 1 cut(s) 76
Fnu4HI GCNGC 1 cut(s) 128
FokI GGATG 1 cut(s) 105
FriOI GRGCYC 1 cut(s) 119
Fsp4HI GCNGC 1 cut(s) 128
FspBI CTAG 1 cut(s) 72
GluI GCNGC 1 cut(s) 128
HaeIII GGCC 1 cut(s) 117
HinfI GANTC 2 cut(s) 79, 151
Hpy188I TCNGA 2 cut(s) 44, 163
Hpy188III TCNNGA 1 cut(s) 186
HpyF10VI GCNNNNNNNGC 1 cut(s) 114
Kzo9I GATC 1 cut(s) 158
LpnPI CCDG 2 cut(s) 74, 124
Lsp1109I GCAGC 1 cut(s) 114
MaeI CTAG 1 cut(s) 72
MalI GATC 1 cut(s) 160
MboI GATC 1 cut(s) 158
MhlI GDGCHC 1 cut(s) 119
MluCI AATT 1 cut(s) 50
MseI TTAA 3 cut(s) 24, 38, 132
MwoI GCNNNNNNNGC 1 cut(s) 114
NdeII GATC 1 cut(s) 158
NlaIV GGNNCC 2 cut(s) 117, 118
PaeR7I CTCGAG 1 cut(s) 169
PfeI GAWTC 2 cut(s) 79, 151
PkrI GCNGC 1 cut(s) 129
PspN4I GGNNCC 2 cut(s) 117, 118
PspOMI GGGCCC 1 cut(s) 115
PspPI GGNCC 3 cut(s) 115, 116, 177
PspXI VCTCGAGB 1 cut(s) 169
SaqAI TTAA 3 cut(s) 24, 38, 132
SatI GCNGC 1 cut(s) 128
Sau3AI GATC 1 cut(s) 158
Sau96I GGNCC 3 cut(s) 115, 116, 177
SduI GDGCHC 1 cut(s) 119
SetI ASST 2 cut(s) 77, 179
Sfr274I CTCGAG 1 cut(s) 169
SgeI CNNG 7 cut(s) 72, 84, 101, 121, 151, 181, 183
SinI GGWCC 1 cut(s) 177
SlaI CTCGAG 1 cut(s) 169
SmlI CTYRAG 1 cut(s) 169
SmoI CTYRAG 1 cut(s) 169
Sse9I AATT 1 cut(s) 50
SsiI CCGC 1 cut(s) 32
SspMI CTAG 1 cut(s) 72
TaqI TCGA 3 cut(s) 145, 157, 170
TasI AATT 1 cut(s) 50
TfiI GAWTC 2 cut(s) 79, 151
Tru1I TTAA 3 cut(s) 24, 38, 132
Tru9I TTAA 3 cut(s) 24, 38, 132
TseI GCWGC 1 cut(s) 127
TspDTI ATGAA 1 cut(s) 143
VpaK11BI GGWCC 1 cut(s) 177
XhoI CTCGAG 1 cut(s) 169
XspI CTAG 1 cut(s) 72
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.