pycom10g22180

purine permease

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr10
Physical Location & Seq
Reverse (-)
24619579 .. 24619863
285 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom10g22180.1

Sequence Viewer

Length: 285 bp
ATGGCAATCCAAATATGTGTTTCATACCAGTTAATTTCTCAGCCCAGAGATTTTACCTGGTGGTGCGTATATCACCATCTAACGCTATTCATTGGATTGATTTTTGAGGTGTCTTCTTTATTCTCCAATGTCATAAGTGCTCCCGGCTTGCCTTTCATTCCAGTTCTAGCTGTAAAGCCTGTAATCTTCTTCAATGATAACATGGACGGAATAAAGGTTATTGCCACCTTGTTGGCCCTCTGGAGCATTGCTTCATATACATGTCTATCGGCACTACCTCGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

95

Amino Acids

10.55

Weight (kDa)

6.68

Isoelectric Point (pI)

24.09

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PUNUT PF16913 30 - 87 8.6e-15 Purine nucleobase transmembrane transport
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0028175)

Species Orthologous Gene IDs
malus_domestica MD10G1266000.v1.1
pyrus_communis pycom10g22180

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflIII ACRYGT 1 cut(s) 260
AgsI TTSAA 1 cut(s) 193
AjnI CCWGG 1 cut(s) 56
AluBI AGCT 1 cut(s) 170
AluI AGCT 1 cut(s) 170
Alw21I GWGCWC 1 cut(s) 142
AoxI GGCC 1 cut(s) 234
AspS9I GGNCC 1 cut(s) 235
AsuC2I CCSGG 1 cut(s) 144
AsuHPI GGTGA 1 cut(s) 65
BbsI GAAGAC 1 cut(s) 105
Bbv12I GWGCWC 1 cut(s) 142
BccI CCATC 1 cut(s) 84
BciT130I CCWGG 1 cut(s) 58
BcnI CCSGG 1 cut(s) 144
BfaI CTAG 1 cut(s) 167
Bme1390I CCNGG 2 cut(s) 58, 144
BmgT120I GGNCC 1 cut(s) 235
BmrFI CCNGG 2 cut(s) 58, 144
BpiI GAAGAC 1 cut(s) 105
BpmI CTGGAG 1 cut(s) 262
BpuMI CCSGG 1 cut(s) 144
Bse1I ACTGG 2 cut(s) 28, 161
Bse3DI GCAATG 1 cut(s) 246
BseBI CCWGG 1 cut(s) 58
BseMI GCAATG 1 cut(s) 246
BseMII CTCAG 1 cut(s) 53
BseNI ACTGG 2 cut(s) 28, 161
BshFI GGCC 1 cut(s) 236
BsiHKAI GWGCWC 1 cut(s) 142
BsiSI CCGG 1 cut(s) 144
BsnI GGCC 1 cut(s) 236
Bsp1286I GDGCHC 1 cut(s) 142
BspANI GGCC 1 cut(s) 236
BspCNI CTCAG 1 cut(s) 52
BsrDI GCAATG 1 cut(s) 246
BsrI ACTGG 2 cut(s) 28, 161
Bst2UI CCWGG 1 cut(s) 58
BstC8I GCNNGC 1 cut(s) 149
BstDEI CTNAG 1 cut(s) 39
BstNI CCWGG 1 cut(s) 58
BstNSI RCATGY 1 cut(s) 264
BstSCI CCNGG 2 cut(s) 56, 142
BstV2I GAAGAC 1 cut(s) 105
BstXI CCANNNNNNTGG 1 cut(s) 232
BsuRI GGCC 1 cut(s) 236
Cac8I GCNNGC 1 cut(s) 149
Cfr13I GGNCC 1 cut(s) 235
CsiI ACCWGGT 1 cut(s) 56
CviAII CATG 2 cut(s) 202, 261
CviJI RGCY 5 cut(s) 43, 147, 170, 178, 236
CviKI_1 RGCY 5 cut(s) 43, 147, 170, 178, 236
DdeI CTNAG 1 cut(s) 39
EcoRII CCWGG 1 cut(s) 56
FaeI CATG 2 cut(s) 205, 264
FaiI YATR 8 cut(s) 16, 25, 70, 134, 203, 256, 258, 262
FatI CATG 2 cut(s) 201, 260
FspBI CTAG 1 cut(s) 167
GsuI CTGGAG 1 cut(s) 262
HaeIII GGCC 1 cut(s) 236
HapII CCGG 1 cut(s) 144
Hin1II CATG 2 cut(s) 205, 264
HpaII CCGG 1 cut(s) 144
HphI GGTGA 1 cut(s) 65
Hpy188III TCNNGA 1 cut(s) 241
HpyF3I CTNAG 1 cut(s) 39
Hsp92II CATG 2 cut(s) 205, 264
LmnI GCTCC 2 cut(s) 145, 243
LpnPI CCDG 8 cut(s) 41, 43, 58, 70, 157, 174, 192, 226
MabI ACCWGGT 1 cut(s) 56
MaeI CTAG 1 cut(s) 167
MboII GAAGA 3 cut(s) 105, 178, 181
MhlI GDGCHC 1 cut(s) 142
MluCI AATT 1 cut(s) 33
MnlI CCTC 2 cut(s) 100, 248
MseI TTAA 1 cut(s) 32
MslI CAYNNNNRTG 1 cut(s) 259
MspI CCGG 1 cut(s) 144
MspR9I CCNGG 2 cut(s) 58, 144
MvaI CCWGG 1 cut(s) 58
NciI CCSGG 1 cut(s) 144
NlaIII CATG 2 cut(s) 205, 264
NspI RCATGY 1 cut(s) 264
PciI ACATGT 1 cut(s) 260
PscI ACATGT 1 cut(s) 260
Psp6I CCWGG 1 cut(s) 56
PspGI CCWGG 1 cut(s) 56
PspPI GGNCC 1 cut(s) 235
RseI CAYNNNNRTG 1 cut(s) 259
SaqAI TTAA 1 cut(s) 32
Sau96I GGNCC 1 cut(s) 235
ScrFI CCNGG 2 cut(s) 58, 144
SduI GDGCHC 1 cut(s) 142
SetI ASST 6 cut(s) 59, 111, 172, 219, 230, 280
SexAI ACCWGGT 1 cut(s) 56
SmiMI CAYNNNNRTG 1 cut(s) 259
Sse9I AATT 1 cut(s) 33
SspMI CTAG 1 cut(s) 167
StyD4I CCNGG 2 cut(s) 56, 142
TaqI TCGA 1 cut(s) 280
TasI AATT 1 cut(s) 33
Tru1I TTAA 1 cut(s) 32
Tru9I TTAA 1 cut(s) 32
TspDTI ATGAA 4 cut(s) 12, 79, 145, 243
TspGWI ACGGA 1 cut(s) 222
XceI RCATGY 1 cut(s) 264
XspI CTAG 1 cut(s) 167
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.