pycom1134g00010

Phosphorylase is an important allosteric enzyme in carbohydrate metabolism. Enzymes from different sources differ in their regulatory mechanisms and in their natural substrates. However, all known phosphorylases share catalytic and structural properties

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00001134
Physical Location & Seq
Forward (+)
15404 .. 17147
1744 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 219 bp
ATGGGCCATTCTCTTCATTGTCAGGAACGATCAAGCGGAGCAGAGACAGTGTGGCATTGCAAATCGCAATCTAAACTGATCGATTTCGGTTCCAGGAAGAACAAATACAGCTTTTGTTCACAAGGACATCGAATGGACTTGGTCGTCTTCGTTCTCAATGAAGAGCGTTCTGGACAAGCCTTATTAGCTCAAGAATCCATTCATCGAACAAGGAAGTAA

Protein Analysis

73

Amino Acids

8.26

Weight (kDa)

9.3

Isoelectric Point (pI)

55.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022413)

Species Orthologous Gene IDs
malus_domestica MD00G1036900.v1.1
pyrus_communis pycom06g01700 pycom1134g00010 pycom17g05640

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 143
AciI CCGC 1 cut(s) 36
AjnI CCWGG 1 cut(s) 92
AluBI AGCT 2 cut(s) 111, 188
AluI AGCT 2 cut(s) 111, 188
Alw26I GTCTC 1 cut(s) 38
AoxI GGCC 1 cut(s) 4
Asp700I GAANNNNTTC 1 cut(s) 198
AspS9I GGNCC 1 cut(s) 4
BarI GAAGNNNNNNTAC 2 cut(s) 89, 121
BbsI GAAGAC 1 cut(s) 139
BciT130I CCWGG 1 cut(s) 94
BcoDI GTCTC 1 cut(s) 38
Bme1390I CCNGG 1 cut(s) 94
BmgT120I GGNCC 1 cut(s) 4
BmiI GGNNCC 1 cut(s) 91
BmrFI CCNGG 1 cut(s) 94
BpiI GAAGAC 1 cut(s) 139
BpuEI CTTGAG 1 cut(s) 174
Bsa29I ATCGAT 1 cut(s) 81
Bse3DI GCAATG 1 cut(s) 55
BseBI CCWGG 1 cut(s) 94
BseCI ATCGAT 1 cut(s) 81
BseMI GCAATG 1 cut(s) 55
BshFI GGCC 1 cut(s) 6
BshVI ATCGAT 1 cut(s) 81
BsmAI GTCTC 1 cut(s) 38
BsnI GGCC 1 cut(s) 6
Bsp143I GATC 2 cut(s) 29, 78
BspACI CCGC 1 cut(s) 36
BspANI GGCC 1 cut(s) 6
BspDI ATCGAT 1 cut(s) 81
BspLI GGNNCC 1 cut(s) 91
BspQI GCTCTTC 1 cut(s) 156
BsrDI GCAATG 1 cut(s) 55
BssMI GATC 2 cut(s) 29, 78
Bst2UI CCWGG 1 cut(s) 94
Bst4CI ACNGT 1 cut(s) 49
Bst6I CTCTTC 2 cut(s) 18, 156
BstKTI GATC 2 cut(s) 32, 81
BstMAI GTCTC 1 cut(s) 38
BstMBI GATC 2 cut(s) 29, 78
BstMWI GCNNNNNNNGC 1 cut(s) 185
BstNI CCWGG 1 cut(s) 94
BstSCI CCNGG 1 cut(s) 92
BstV2I GAAGAC 1 cut(s) 139
Bsu15I ATCGAT 1 cut(s) 81
BsuRI GGCC 1 cut(s) 6
BsuTUI ATCGAT 1 cut(s) 81
BtsIMutI CAGTG 1 cut(s) 54
Cfr13I GGNCC 1 cut(s) 4
ClaI ATCGAT 1 cut(s) 81
CviJI RGCY 4 cut(s) 6, 111, 179, 188
CviKI_1 RGCY 4 cut(s) 6, 111, 179, 188
DpnI GATC 2 cut(s) 31, 80
DpnII GATC 2 cut(s) 29, 78
DrdI GACNNNNNNGTC 1 cut(s) 143
DseDI GACNNNNNNGTC 1 cut(s) 143
Eam1104I CTCTTC 2 cut(s) 18, 156
EarI CTCTTC 2 cut(s) 18, 156
EcoRII CCWGG 1 cut(s) 92
HaeIII GGCC 1 cut(s) 6
HinfI GANTC 1 cut(s) 194
Hpy166II GTNNAC 1 cut(s) 119
Hpy188III TCNNGA 3 cut(s) 23, 171, 191
Hpy8I GTNNAC 1 cut(s) 119
HpyCH4III ACNGT 1 cut(s) 49
HpyCH4V TGCA 1 cut(s) 60
HpyF10VI GCNNNNNNNGC 1 cut(s) 185
Kzo9I GATC 2 cut(s) 29, 78
LguI GCTCTTC 1 cut(s) 156
LmnI GCTCC 1 cut(s) 38
LpnPI CCDG 4 cut(s) 8, 79, 106, 156
MalI GATC 2 cut(s) 31, 80
MboI GATC 2 cut(s) 29, 78
MboII GAAGA 4 cut(s) 5, 109, 139, 173
MroXI GAANNNNTTC 1 cut(s) 198
MspR9I CCNGG 1 cut(s) 94
MvaI CCWGG 1 cut(s) 94
MwoI GCNNNNNNNGC 1 cut(s) 185
NdeII GATC 2 cut(s) 29, 78
NlaIV GGNNCC 1 cut(s) 91
PciSI GCTCTTC 1 cut(s) 156
PdmI GAANNNNTTC 1 cut(s) 198
PfeI GAWTC 1 cut(s) 194
PflFI GACNNNGTC 1 cut(s) 140
PfoI TCCNGGA 1 cut(s) 92
Psp6I CCWGG 1 cut(s) 92
PspGI CCWGG 1 cut(s) 92
PspN4I GGNNCC 1 cut(s) 91
PspPI GGNCC 1 cut(s) 4
PsyI GACNNNGTC 1 cut(s) 140
SapI GCTCTTC 1 cut(s) 156
Sau3AI GATC 2 cut(s) 29, 78
Sau96I GGNCC 1 cut(s) 4
ScrFI CCNGG 1 cut(s) 94
SetI ASST 2 cut(s) 113, 190
SgeI CNNG 9 cut(s) 35, 45, 105, 106, 134, 151, 183, 188, 203
SmlI CTYRAG 1 cut(s) 189
SmoI CTYRAG 1 cut(s) 189
SsiI CCGC 1 cut(s) 36
StyD4I CCNGG 1 cut(s) 92
TaaI ACNGT 1 cut(s) 49
TaqI TCGA 3 cut(s) 81, 130, 205
TfiI GAWTC 1 cut(s) 194
TscAI CASTG 1 cut(s) 54
TspDTI ATGAA 3 cut(s) 5, 174, 191
TspRI CASTG 1 cut(s) 54
Tth111I GACNNNGTC 1 cut(s) 140
XmnI GAANNNNTTC 1 cut(s) 198
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.