pycom11g03150

DEAD-box ATP-dependent RNA helicase

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
Physical Location & Seq
Reverse (-)
2431328 .. 2431683
356 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 303 bp
ATGCATTTATCCTGTGAAATGGATGTGAAATATGTTATCAATTACGACTTTCCAGGATCCCTTGATAATTATGTTTACCACATTGACCGTTTTGGAAGTGCTGCAGCAAAGGGAACAGCATACACATTCTTTACAACTGCTAATGCTGGATGCGCAAAGGAACTTACCATCTTACTCAAGAAAGCTGGACAGAATGTTAGTTCTGAATTGGAACAACTGTGGCGTGATGTAACATATCCAGGTCAGCGTTGGGTAAATTATTCGGTTTTAAGTTTAGTTATGGTTACTGTGGTATCTGCCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

101

Amino Acids

11.18

Weight (kDa)

6.03

Isoelectric Point (pI)

38.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024262)

Species Orthologous Gene IDs
malus_domestica MD14G1172400.v1.1
pyrus_communis pycom11g03150
rosa_multiflora Rmu_co8128650.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 154
AclWI GGATC 2 cut(s) 51, 64
AjnI CCWGG 2 cut(s) 52, 238
AluBI AGCT 1 cut(s) 185
AluI AGCT 1 cut(s) 185
AlwI GGATC 2 cut(s) 51, 64
ApeKI GCWGC 2 cut(s) 101, 104
AspLEI GCGC 1 cut(s) 155
BaeI ACNNNNGTAYC 1 cut(s) 276
BamHI GGATCC 1 cut(s) 56
BbvI GCAGC 2 cut(s) 88, 116
BccI CCATC 1 cut(s) 176
BciT130I CCWGG 2 cut(s) 54, 240
BfaI CTAG 1 cut(s) 301
BfmI CTRYAG 1 cut(s) 102
BisI GCNGC 2 cut(s) 102, 105
BlsI GCNGC 2 cut(s) 103, 106
Bme1390I CCNGG 2 cut(s) 54, 240
BmiI GGNNCC 1 cut(s) 58
BmrFI CCNGG 2 cut(s) 54, 240
BmsI GCATC 1 cut(s) 140
BpuEI CTTGAG 1 cut(s) 161
BseBI CCWGG 2 cut(s) 54, 240
BseGI GGATG 2 cut(s) 28, 155
BseXI GCAGC 2 cut(s) 88, 116
Bsp143I GATC 1 cut(s) 56
BspLI GGNNCC 1 cut(s) 58
BspMAI CTGCAG 1 cut(s) 106
BspPI GGATC 2 cut(s) 51, 64
BssMI GATC 1 cut(s) 56
Bst2UI CCWGG 2 cut(s) 54, 240
Bst4CI ACNGT 3 cut(s) 89, 219, 289
BstF5I GGATG 2 cut(s) 28, 155
BstHHI GCGC 1 cut(s) 155
BstKTI GATC 1 cut(s) 59
BstMBI GATC 1 cut(s) 56
BstMWI GCNNNNNNNGC 1 cut(s) 152
BstNI CCWGG 2 cut(s) 54, 240
BstSCI CCNGG 2 cut(s) 52, 238
BstSFI CTRYAG 1 cut(s) 102
BstV1I GCAGC 2 cut(s) 88, 116
BstX2I RGATCY 1 cut(s) 56
BstYI RGATCY 1 cut(s) 56
BtsCI GGATG 2 cut(s) 28, 155
CfoI GCGC 1 cut(s) 155
CviJI RGCY 1 cut(s) 185
CviKI_1 RGCY 1 cut(s) 185
DpnI GATC 1 cut(s) 58
DpnII GATC 1 cut(s) 56
EcoRII CCWGG 2 cut(s) 52, 238
EcoT22I ATGCAT 1 cut(s) 6
FaiI YATR 5 cut(s) 33, 72, 121, 235, 281
Fnu4HI GCNGC 2 cut(s) 102, 105
FokI GGATG 2 cut(s) 35, 162
Fsp4HI GCNGC 2 cut(s) 102, 105
FspBI CTAG 1 cut(s) 301
FspI TGCGCA 1 cut(s) 154
GlaI GCGC 1 cut(s) 154
GluI GCNGC 2 cut(s) 102, 105
HhaI GCGC 1 cut(s) 155
Hin6I GCGC 1 cut(s) 153
HinP1I GCGC 1 cut(s) 153
Hpy166II GTNNAC 1 cut(s) 76
Hpy188I TCNGA 1 cut(s) 205
Hpy188III TCNNGA 1 cut(s) 178
Hpy8I GTNNAC 1 cut(s) 76
HpyCH4III ACNGT 3 cut(s) 89, 219, 289
HpyCH4V TGCA 2 cut(s) 4, 104
HpyF10VI GCNNNNNNNGC 1 cut(s) 152
HspAI GCGC 1 cut(s) 153
Kzo9I GATC 1 cut(s) 56
LpnPI CCDG 7 cut(s) 25, 39, 66, 132, 171, 225, 252
Lsp1109I GCAGC 2 cut(s) 88, 116
LweI GCATC 1 cut(s) 140
MaeI CTAG 1 cut(s) 301
MaeIII GTNAC 2 cut(s) 229, 283
MalI GATC 1 cut(s) 58
MboI GATC 1 cut(s) 56
MflI RGATCY 1 cut(s) 56
MluCI AATT 4 cut(s) 40, 67, 206, 256
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 1 cut(s) 269
MspR9I CCNGG 2 cut(s) 54, 240
MvaI CCWGG 2 cut(s) 54, 240
MwoI GCNNNNNNNGC 1 cut(s) 152
NdeII GATC 1 cut(s) 56
NlaIV GGNNCC 1 cut(s) 58
NsbI TGCGCA 1 cut(s) 154
NsiI ATGCAT 1 cut(s) 6
PfoI TCCNGGA 1 cut(s) 52
PkrI GCNGC 2 cut(s) 103, 106
Psp6I CCWGG 2 cut(s) 52, 238
PspGI CCWGG 2 cut(s) 52, 238
PspN4I GGNNCC 1 cut(s) 58
PstI CTGCAG 1 cut(s) 106
PsuI RGATCY 1 cut(s) 56
SaqAI TTAA 1 cut(s) 269
SatI GCNGC 2 cut(s) 102, 105
Sau3AI GATC 1 cut(s) 56
ScrFI CCNGG 2 cut(s) 54, 240
SetI ASST 2 cut(s) 187, 244
SfaNI GCATC 1 cut(s) 140
SfcI CTRYAG 1 cut(s) 102
SmlI CTYRAG 1 cut(s) 176
SmoI CTYRAG 1 cut(s) 176
Sse9I AATT 4 cut(s) 40, 67, 206, 256
SspMI CTAG 1 cut(s) 301
StyD4I CCNGG 2 cut(s) 52, 238
TaaI ACNGT 3 cut(s) 89, 219, 289
TasI AATT 4 cut(s) 40, 67, 206, 256
Tru1I TTAA 1 cut(s) 269
Tru9I TTAA 1 cut(s) 269
TseI GCWGC 2 cut(s) 101, 104
XcmI CCANNNNNNNNNTGG 1 cut(s) 246
XspI CTAG 1 cut(s) 301
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.