pycom11g20320

D-ala D-ala ligase N-terminus

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
Physical Location & Seq
Forward (+)
23227683 .. 23228914
1232 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 405 bp
ATGGATCCCATCCCAATTAGGTTTTACCCACTCACTCTGTCACTCACCTCACCCTCCCTCACCTCACTCACACGGCCTCACCCCTCTCACATCCCCATTCTCCCATTTCGCACATCCGAGATCCGACCCTTACCACGGCCCCTCATCCAAAAATATCAACAATTCACCCATAACCTCAGCTTCTGCGACGGCCCTCATCATCCATCATTCGCGACAACTCACGAATCTTCGTCCTCCGTCCTTCGTCCTTGTGGCACAATTGATGACAAAAATCAAGAATCTATCTTCACTGTGAGGAGAAAAGAAGATCTCATTAGTTCATCAATACCAAATCTATGGCATGAATTGACCTCAAAGCTTCACTGTAAAAGCATTGGAAGACTGTCTTCATTGGATTCCTCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

135

Amino Acids

15.17

Weight (kDa)

8.96

Isoelectric Point (pI)

64.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0028920)

Species Orthologous Gene IDs
malus_domestica MD11G1250900.v1.1
pyrus_communis pycom11g20320

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 212
AclWI GGATC 2 cut(s) 12, 115
AfiI CCNNNNNNNGG 1 cut(s) 135
AluBI AGCT 2 cut(s) 180, 358
AluI AGCT 2 cut(s) 180, 358
AlwI GGATC 2 cut(s) 12, 115
AlwNI CAGNNNCTG 1 cut(s) 183
AoxI GGCC 3 cut(s) 74, 137, 190
AspS9I GGNCC 2 cut(s) 138, 191
AsuHPI GGTGA 5 cut(s) 37, 42, 52, 71, 157
BamHI GGATCC 1 cut(s) 4
BbsI GAAGAC 2 cut(s) 378, 385
BbvCI CCTCAGC 1 cut(s) 176
BccI CCATC 2 cut(s) 17, 211
BceAI ACGGC 3 cut(s) 89, 152, 205
BglII AGATCT 1 cut(s) 307
BmgT120I GGNCC 2 cut(s) 138, 191
BmiI GGNNCC 2 cut(s) 6, 140
BpiI GAAGAC 2 cut(s) 378, 385
Bpu10I CCTNAGC 1 cut(s) 176
BsaJI CCNNGG 1 cut(s) 134
Bsc4I CCNNNNNNNGG 1 cut(s) 135
BseDI CCNNGG 1 cut(s) 134
BseGI GGATG 5 cut(s) 9, 90, 113, 144, 199
BseLI CCNNNNNNNGG 1 cut(s) 135
BseMII CTCAG 1 cut(s) 190
BseRI GAGGAG 1 cut(s) 310
Bsh1236I CGCG 1 cut(s) 212
BshFI GGCC 3 cut(s) 76, 139, 192
BslI CCNNNNNNNGG 1 cut(s) 135
BsnI GGCC 3 cut(s) 76, 139, 192
Bsp143I GATC 3 cut(s) 4, 120, 307
Bsp68I TCGCGA 1 cut(s) 212
BspANI GGCC 3 cut(s) 76, 139, 192
BspCNI CTCAG 1 cut(s) 189
BspFNI CGCG 1 cut(s) 212
BspLI GGNNCC 2 cut(s) 6, 140
BspPI GGATC 2 cut(s) 12, 115
BssECI CCNNGG 1 cut(s) 134
BssMI GATC 3 cut(s) 4, 120, 307
Bst4CI ACNGT 3 cut(s) 292, 365, 384
BstDEI CTNAG 1 cut(s) 176
BstDSI CCRYGG 1 cut(s) 134
BstF5I GGATG 5 cut(s) 9, 90, 113, 144, 199
BstFNI CGCG 1 cut(s) 212
BstKTI GATC 3 cut(s) 7, 123, 310
BstMBI GATC 3 cut(s) 4, 120, 307
BstUI CGCG 1 cut(s) 212
BstV2I GAAGAC 2 cut(s) 378, 385
BstX2I RGATCY 3 cut(s) 4, 120, 307
BstXI CCANNNNNNTGG 1 cut(s) 336
BstYI RGATCY 3 cut(s) 4, 120, 307
BsuRI GGCC 3 cut(s) 76, 139, 192
BtgI CCRYGG 1 cut(s) 134
BtsCI GGATG 5 cut(s) 9, 90, 113, 144, 199
BtsIMutI CAGTG 2 cut(s) 288, 361
BtuMI TCGCGA 1 cut(s) 212
CaiI CAGNNNCTG 1 cut(s) 183
Cfr13I GGNCC 2 cut(s) 138, 191
CviAII CATG 1 cut(s) 341
CviJI RGCY 5 cut(s) 76, 139, 180, 192, 358
CviKI_1 RGCY 5 cut(s) 76, 139, 180, 192, 358
DdeI CTNAG 1 cut(s) 176
DpnI GATC 3 cut(s) 6, 122, 309
DpnII GATC 3 cut(s) 4, 120, 307
FaeI CATG 1 cut(s) 344
FaiI YATR 3 cut(s) 171, 337, 342
FalI AAGNNNNNCTT 2 cut(s) 370, 402
FatI CATG 1 cut(s) 340
FokI GGATG 4 cut(s) 77, 100, 131, 186
HaeIII GGCC 3 cut(s) 76, 139, 192
Hin1II CATG 1 cut(s) 344
HindIII AAGCTT 1 cut(s) 356
HinfI GANTC 3 cut(s) 224, 278, 395
HphI GGTGA 5 cut(s) 37, 42, 52, 71, 157
Hpy188I TCNGA 2 cut(s) 118, 125
Hpy188III TCNNGA 3 cut(s) 211, 221, 275
Hpy99I CGWCG 1 cut(s) 191
HpyAV CCTTC 1 cut(s) 251
HpyCH4III ACNGT 3 cut(s) 292, 365, 384
HpyF3I CTNAG 1 cut(s) 176
Hsp92II CATG 1 cut(s) 344
Kzo9I GATC 3 cut(s) 4, 120, 307
MaeIII GTNAC 1 cut(s) 39
MalI GATC 3 cut(s) 6, 122, 309
MboI GATC 3 cut(s) 4, 120, 307
MboII GAAGA 5 cut(s) 219, 277, 317, 378, 390
MfeI CAATTG 1 cut(s) 258
MflI RGATCY 3 cut(s) 4, 120, 307
MluCI AATT 4 cut(s) 15, 161, 258, 344
MmeI TCCRAC 1 cut(s) 148
MunI CAATTG 1 cut(s) 258
MvnI CGCG 1 cut(s) 212
NdeII GATC 3 cut(s) 4, 120, 307
NlaIII CATG 1 cut(s) 344
NlaIV GGNNCC 2 cut(s) 6, 140
NmuCI GTSAC 1 cut(s) 39
NruI TCGCGA 1 cut(s) 212
PfeI GAWTC 3 cut(s) 224, 278, 395
PspN4I GGNNCC 2 cut(s) 6, 140
PspPI GGNCC 2 cut(s) 138, 191
PstNI CAGNNNCTG 1 cut(s) 183
PsuI RGATCY 3 cut(s) 4, 120, 307
RruI TCGCGA 1 cut(s) 212
Sau3AI GATC 3 cut(s) 4, 120, 307
Sau96I GGNCC 2 cut(s) 138, 191
SetI ASST 7 cut(s) 23, 50, 65, 177, 182, 353, 360
SgeI CNNG 8 cut(s) 84, 130, 147, 223, 233, 261, 287, 353
Sse9I AATT 4 cut(s) 15, 161, 258, 344
TaaI ACNGT 3 cut(s) 292, 365, 384
TasI AATT 4 cut(s) 15, 161, 258, 344
TfiI GAWTC 3 cut(s) 224, 278, 395
TscAI CASTG 2 cut(s) 295, 368
TseFI GTSAC 1 cut(s) 39
Tsp45I GTSAC 1 cut(s) 39
TspDTI ATGAA 3 cut(s) 309, 357, 378
TspGWI ACGGA 1 cut(s) 226
TspRI CASTG 2 cut(s) 295, 368
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.