pycom11g23230

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
Physical Location & Seq
Forward (+)
26257386 .. 26257604
219 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom11g23230.1

Sequence Viewer

Length: 219 bp
ATGCTGAGTCAAGACCCTTCCCTCTCTAAAACCCTAAAACCTTCTCTTTTCCTCCTCACGTCATTCTTCAATCTCCTCCGCAAAAACCTAACCCTAAAAGCCCTCACCGCAGCCCCCAAAACACTCTCCATCAACTCGCTCTCCCAATTCCCGCAAAATTTGGATCCCAATTTCACATTTTCCTGCCAAATTTCCCAACTCTGGCGGGACCTCCGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

73

Amino Acids

8.2

Weight (kDa)

10.18

Isoelectric Point (pI)

41.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029408)

Species Orthologous Gene IDs
pyrus_communis pycom11g23230
rosa_multiflora Rmu_sc0036967.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 5 cut(s) 79, 108, 152, 205, 214
AclWI GGATC 2 cut(s) 158, 171
AcsI RAATTY 2 cut(s) 157, 189
AfiI CCNNNNNNNGG 1 cut(s) 201
AgsI TTSAA 1 cut(s) 70
AjiI CACGTC 1 cut(s) 60
AlwI GGATC 2 cut(s) 158, 171
ApeKI GCWGC 1 cut(s) 110
ApoI RAATTY 2 cut(s) 157, 189
AspS9I GGNCC 1 cut(s) 208
AsuHPI GGTGA 1 cut(s) 97
AvaII GGWCC 1 cut(s) 208
BamHI GGATCC 1 cut(s) 163
BbvI GCAGC 1 cut(s) 122
BccI CCATC 1 cut(s) 137
BisI GCNGC 1 cut(s) 111
BlsI GCNGC 1 cut(s) 112
Bme18I GGWCC 1 cut(s) 208
BmgBI CACGTC 1 cut(s) 60
BmgT120I GGNCC 1 cut(s) 208
BmiI GGNNCC 2 cut(s) 165, 209
BsaXI ACNNNNNCTCC 2 cut(s) 125, 155
Bsc4I CCNNNNNNNGG 1 cut(s) 201
BseLI CCNNNNNNNGG 1 cut(s) 201
BseRI GAGGAG 2 cut(s) 44, 65
BseXI GCAGC 1 cut(s) 122
BslI CCNNNNNNNGG 1 cut(s) 201
Bsp143I GATC 1 cut(s) 163
BspACI CCGC 5 cut(s) 79, 108, 152, 205, 214
BspLI GGNNCC 2 cut(s) 165, 209
BspPI GGATC 2 cut(s) 158, 171
BssMI GATC 1 cut(s) 163
BstDEI CTNAG 1 cut(s) 5
BstKTI GATC 1 cut(s) 166
BstMBI GATC 1 cut(s) 163
BstMWI GCNNNNNNNGC 1 cut(s) 107
BstV1I GCAGC 1 cut(s) 122
BstX2I RGATCY 1 cut(s) 163
BstYI RGATCY 1 cut(s) 163
BtrI CACGTC 1 cut(s) 60
Cfr13I GGNCC 1 cut(s) 208
CviJI RGCY 2 cut(s) 101, 113
CviKI_1 RGCY 2 cut(s) 101, 113
DdeI CTNAG 1 cut(s) 5
DpnI GATC 1 cut(s) 165
DpnII GATC 1 cut(s) 163
Eco47I GGWCC 1 cut(s) 208
EcoO109I RGGNCCY 1 cut(s) 208
FauI CCCGC 2 cut(s) 159, 198
Fnu4HI GCNGC 1 cut(s) 111
Fsp4HI GCNGC 1 cut(s) 111
GluI GCNGC 1 cut(s) 111
HinfI GANTC 1 cut(s) 7
HphI GGTGA 1 cut(s) 97
Hpy188III TCNNGA 1 cut(s) 11
HpyAV CCTTC 2 cut(s) 27, 51
HpyCH4IV ACGT 1 cut(s) 59
HpyF10VI GCNNNNNNNGC 1 cut(s) 107
HpyF3I CTNAG 1 cut(s) 5
HpySE526I ACGT 1 cut(s) 59
Kzo9I GATC 1 cut(s) 163
LpnPI CCDG 2 cut(s) 187, 196
Lsp1109I GCAGC 1 cut(s) 122
MaeII ACGT 1 cut(s) 59
MalI GATC 1 cut(s) 165
MboI GATC 1 cut(s) 163
MboII GAAGA 1 cut(s) 58
MflI RGATCY 1 cut(s) 163
MluCI AATT 4 cut(s) 146, 157, 169, 189
MlyI GAGTC 1 cut(s) 16
MnlI CCTC 5 cut(s) 32, 62, 65, 86, 113
MwoI GCNNNNNNNGC 1 cut(s) 107
NdeII GATC 1 cut(s) 163
NlaIV GGNNCC 2 cut(s) 165, 209
PkrI GCNGC 1 cut(s) 112
PleI GAGTC 1 cut(s) 15
PpsI GAGTC 1 cut(s) 15
PpuMI RGGWCCY 1 cut(s) 208
Psp5II RGGWCCY 1 cut(s) 208
PspN4I GGNNCC 2 cut(s) 165, 209
PspPI GGNCC 1 cut(s) 208
PspPPI RGGWCCY 1 cut(s) 208
PsuI RGATCY 1 cut(s) 163
SatI GCNGC 1 cut(s) 111
Sau3AI GATC 1 cut(s) 163
Sau96I GGNCC 1 cut(s) 208
SchI GAGTC 1 cut(s) 16
SetI ASST 4 cut(s) 43, 62, 90, 213
SgeI CNNG 6 cut(s) 23, 70, 148, 163, 195, 214
SinI GGWCC 1 cut(s) 208
Sse9I AATT 4 cut(s) 146, 157, 169, 189
SsiI CCGC 5 cut(s) 79, 108, 152, 205, 214
TaiI ACGT 1 cut(s) 62
TasI AATT 4 cut(s) 146, 157, 169, 189
TseI GCWGC 1 cut(s) 110
VpaK11BI GGWCC 1 cut(s) 208
XapI RAATTY 2 cut(s) 157, 189
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.