pycom12420g00040

AAA domain

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00012420
Physical Location & Seq
Forward (+)
51484 .. 51896
413 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 372 bp
ATGACTCGAAGTTCTCAACCTATTTGTGAGCATATCTTTGATTTTGACGATAACTTTGAGCGAACTTTGAGAAGAAAGAGGAATGATGATAGGAGCATATTTAGTCATAGTTGTTTTAGTCTTTTAAAGTATTTTCGTGTGTTTTTAGGTTCTAATGGCAAAGGGAGCAATAAAGTGCATTTTGAGGCTATTTGGAGCATTTTTGGGCATGGATTGGATAACTTAACCATGGAGCAAAGAGGATGGACGAAATTGAAGACTAGAAGAGTTAGGAAAGGCTACAAATCTGGTGGAAGAAGTCCTAATACAATGAAGATAAGGAAGAAGCAAGAAACAAGGAACCTTATCCAACCTTATCTTATCCTATCCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

124

Amino Acids

14.56

Weight (kDa)

10.5

Isoelectric Point (pI)

49.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022308)

Species Orthologous Gene IDs
malus_domestica MD08G1138300.v1.1 MD13G1271800.v1.1 MD13G1274300.v1.1
pyrus_communis pycom12420g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 256
ArsI GACNNNNNNTTYG 2 cut(s) 38, 70
BarI GAAGNNNNNNTAC 2 cut(s) 289, 321
BbsI GAAGAC 1 cut(s) 263
BccI CCATC 1 cut(s) 237
BfaI CTAG 2 cut(s) 261, 370
BmiI GGNNCC 1 cut(s) 341
BpiI GAAGAC 1 cut(s) 263
BsaJI CCNNGG 1 cut(s) 228
BseDI CCNNGG 1 cut(s) 228
BseGI GGATG 1 cut(s) 248
Bsp19I CCATGG 1 cut(s) 228
BspLI GGNNCC 1 cut(s) 341
BssECI CCNNGG 1 cut(s) 228
BssT1I CCWWGG 1 cut(s) 228
Bst6I CTCTTC 1 cut(s) 259
BstDSI CCRYGG 1 cut(s) 228
BstF5I GGATG 1 cut(s) 248
BstMWI GCNNNNNNNGC 1 cut(s) 165
BstV2I GAAGAC 1 cut(s) 263
BtgI CCRYGG 1 cut(s) 228
BtsCI GGATG 1 cut(s) 248
CspCI CAANNNNNGTGG 2 cut(s) 271, 306
CviAII CATG 2 cut(s) 209, 229
CviJI RGCY 2 cut(s) 188, 279
CviKI_1 RGCY 2 cut(s) 188, 279
DraI TTTAAA 1 cut(s) 126
Eam1104I CTCTTC 1 cut(s) 259
EarI CTCTTC 1 cut(s) 259
Eco130I CCWWGG 1 cut(s) 228
EcoT14I CCWWGG 1 cut(s) 228
ErhI CCWWGG 1 cut(s) 228
FaeI CATG 2 cut(s) 212, 232
FaiI YATR 5 cut(s) 33, 98, 108, 210, 230
FatI CATG 2 cut(s) 208, 228
FokI GGATG 1 cut(s) 255
FspBI CTAG 2 cut(s) 261, 370
Hin1II CATG 2 cut(s) 212, 232
HinfI GANTC 1 cut(s) 4
HpyCH4V TGCA 1 cut(s) 178
HpyF10VI GCNNNNNNNGC 1 cut(s) 165
Hsp92II CATG 2 cut(s) 212, 232
LmnI GCTCC 4 cut(s) 93, 165, 195, 232
LpnPI CCDG 1 cut(s) 273
MaeI CTAG 2 cut(s) 261, 370
MboII GAAGA 6 cut(s) 84, 268, 276, 306, 325, 334
MluCI AATT 1 cut(s) 251
MnlI CCTC 3 cut(s) 72, 178, 233
MseI TTAA 2 cut(s) 125, 224
MwoI GCNNNNNNNGC 1 cut(s) 165
NcoI CCATGG 1 cut(s) 228
NlaIII CATG 2 cut(s) 212, 232
NlaIV GGNNCC 1 cut(s) 341
PspN4I GGNNCC 1 cut(s) 341
SaqAI TTAA 2 cut(s) 125, 224
SetI ASST 4 cut(s) 22, 151, 345, 355
SgeI CNNG 8 cut(s) 18, 149, 221, 241, 273, 300, 341, 348
Sse9I AATT 1 cut(s) 251
SspMI CTAG 2 cut(s) 261, 370
StyI CCWWGG 1 cut(s) 228
TaqI TCGA 1 cut(s) 7
TasI AATT 1 cut(s) 251
Tru1I TTAA 2 cut(s) 125, 224
Tru9I TTAA 2 cut(s) 125, 224
TspDTI ATGAA 1 cut(s) 326
XspI CTAG 2 cut(s) 261, 370
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.