pycom12g04310

protein ubiquitination

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
Physical Location & Seq
Forward (+)
4186264 .. 4186847
584 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12g04310.3

Sequence Viewer

Length: 258 bp
ATGACATTTGCAATTATAAAAAAAAAATTGGGGTCCAGTGTTCCATTCATCATTTCTACTTCAAGTGGAATTTTTGGAAGAGATGCTCTTACCCATGAATTCAAAGAGGTTAGGTGGGGAGAGGTTTGTGGTGATGGAAGTGATGAAGATTGCTCTATACCAGCAAATGATGTGACCTATGACATCCTTTTGACTGTTGGCTTTGTGCCAGGATTGAAAGTTGATGCCATCCTGCTATTACGAACAATAAAGATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

86

Amino Acids

9.23

Weight (kDa)

5.17

Isoelectric Point (pI)

28.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022533)

Species Orthologous Gene IDs
pyrus_communis pycom02g25800 pycom05g30910 pycom12g04310 pycom13g15270

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 17
AcsI RAATTY 2 cut(s) 69, 98
AgsI TTSAA 3 cut(s) 63, 103, 217
AjnI CCWGG 1 cut(s) 208
ApoI RAATTY 2 cut(s) 69, 98
AspS9I GGNCC 1 cut(s) 33
AsuHPI GGTGA 1 cut(s) 143
AvaII GGWCC 1 cut(s) 33
BccI CCATC 2 cut(s) 128, 236
BciT130I CCWGG 1 cut(s) 210
Bme1390I CCNGG 1 cut(s) 210
Bme18I GGWCC 1 cut(s) 33
BmgT120I GGNCC 1 cut(s) 33
BmiI GGNNCC 1 cut(s) 34
BmrFI CCNGG 1 cut(s) 210
BmsI GCATC 2 cut(s) 73, 214
Bse1I ACTGG 1 cut(s) 36
BseBI CCWGG 1 cut(s) 210
BseGI GGATG 2 cut(s) 183, 228
BseNI ACTGG 1 cut(s) 36
BspLI GGNNCC 1 cut(s) 34
BsrI ACTGG 1 cut(s) 36
Bst2UI CCWGG 1 cut(s) 210
Bst4CI ACNGT 1 cut(s) 196
Bst6I CTCTTC 1 cut(s) 73
BstF5I GGATG 2 cut(s) 183, 228
BstNI CCWGG 1 cut(s) 210
BstSCI CCNGG 1 cut(s) 208
BtsCI GGATG 2 cut(s) 183, 228
BtsIMutI CAGTG 1 cut(s) 43
Cfr13I GGNCC 1 cut(s) 33
CviAII CATG 1 cut(s) 95
CviJI RGCY 1 cut(s) 201
CviKI_1 RGCY 1 cut(s) 201
Eam1104I CTCTTC 1 cut(s) 73
EarI CTCTTC 1 cut(s) 73
Eco47I GGWCC 1 cut(s) 33
EcoRI GAATTC 1 cut(s) 98
EcoRII CCWGG 1 cut(s) 208
FaeI CATG 1 cut(s) 98
FaiI YATR 5 cut(s) 17, 96, 158, 180, 256
FatI CATG 1 cut(s) 94
FokI GGATG 2 cut(s) 170, 215
Hin1II CATG 1 cut(s) 98
HphI GGTGA 1 cut(s) 143
HpyCH4III ACNGT 1 cut(s) 196
HpyCH4V TGCA 1 cut(s) 11
Hsp92II CATG 1 cut(s) 98
LpnPI CCDG 5 cut(s) 49, 174, 195, 222, 245
LweI GCATC 2 cut(s) 73, 214
MaeIII GTNAC 1 cut(s) 172
MboII GAAGA 2 cut(s) 90, 158
MluCI AATT 4 cut(s) 12, 26, 69, 98
MnlI CCTC 2 cut(s) 100, 115
MspR9I CCNGG 1 cut(s) 210
MvaI CCWGG 1 cut(s) 210
NlaIII CATG 1 cut(s) 98
NlaIV GGNNCC 1 cut(s) 34
NmuCI GTSAC 1 cut(s) 172
PsiI TTATAA 1 cut(s) 17
Psp6I CCWGG 1 cut(s) 208
PspGI CCWGG 1 cut(s) 208
PspN4I GGNNCC 1 cut(s) 34
PspPI GGNCC 1 cut(s) 33
Sau96I GGNCC 1 cut(s) 33
ScrFI CCNGG 1 cut(s) 210
SetI ASST 4 cut(s) 111, 116, 126, 179
SfaNI GCATC 2 cut(s) 73, 214
SgeI CNNG 7 cut(s) 48, 75, 107, 173, 221, 222, 244
SinI GGWCC 1 cut(s) 33
Sse9I AATT 4 cut(s) 12, 26, 69, 98
StyD4I CCNGG 1 cut(s) 208
TaaI ACNGT 1 cut(s) 196
TasI AATT 4 cut(s) 12, 26, 69, 98
TscAI CASTG 1 cut(s) 43
TseFI GTSAC 1 cut(s) 172
Tsp45I GTSAC 1 cut(s) 172
TspDTI ATGAA 3 cut(s) 37, 111, 159
TspRI CASTG 1 cut(s) 43
VpaK11BI GGWCC 1 cut(s) 33
XapI RAATTY 2 cut(s) 69, 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.