pycom12g12150

Component of the cytosolic iron-sulfur (Fe-S) protein assembly (CIA) machinery. Required for the maturation of extramitochondrial Fe-S proteins. Part of an electron transfer chain functioning in an early step of cytosolic Fe-S biogenesis. Electrons are transferred to the Fe-S cluster from NADPH via a FAD- and FMN-containing diflavin oxidoreductase. Has anti- apoptotic effects in the cell

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
Physical Location & Seq
Reverse (-)
14672757 .. 14674258
1502 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12g12150.1

Sequence Viewer

Length: 381 bp
ATGGCGAATCCGGCTTCAATCAAACCTGTGGATTTGCCAAAAATTGAGTTGGAAGATGATGGTCTGATTGATGGGGATAGTTTGTTGACAGAGGAGGATAGGAAGAGACCCGATCTACCTGTTGCAGTTACAATCCCAAGTAAACCACCTTGCAAGAAAGTAGAGATGTGTGGATTCGGGGATGCTTTTCGATGCTCTGCATGTCCTGTTAAGGCAGGCTGTGCTGTTGATTTCACCAATTTCGAGAGGCATTGTGACTTTGAAAGATGTAAACAAGAGGATGCTTTTCGTTGCTCTGCGTGTCCTTTTAAGGGTCTCCCTAGTTTGGAAAAAGGCAATGAGGTACATTTGTCGGCCAAGTTCAGTGAACCAGACAGCTAG
Functional Annotation

Protein Analysis

127

Amino Acids

13.81

Weight (kDa)

4.93

Isoelectric Point (pI)

50.47

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CIAPIN1 PF05093 75 - 117 2.8e-08 Cytokine-induced anti-apoptosis inhibitor 1, Fe-S biogenesis
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0028725)

Species Orthologous Gene IDs
malus_domestica MD12G1122700.v1.1
pyrus_communis pycom12g12150

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 354
AfaI GTAC 1 cut(s) 345
AfiI CCNNNNNNNGG 2 cut(s) 311, 325
AgsI TTSAA 2 cut(s) 18, 263
AluBI AGCT 1 cut(s) 378
AluI AGCT 1 cut(s) 378
Alw26I GTCTC 2 cut(s) 100, 320
AoxI GGCC 1 cut(s) 354
AsuHPI GGTGA 1 cut(s) 226
BaeI ACNNNNGTAYC 2 cut(s) 335, 368
BccI CCATC 2 cut(s) 53, 65
BcoDI GTCTC 2 cut(s) 100, 320
BfaI CTAG 2 cut(s) 321, 379
BmsI GCATC 3 cut(s) 172, 182, 271
BsaI GGTCTC 2 cut(s) 100, 320
Bsc4I CCNNNNNNNGG 2 cut(s) 311, 325
Bse3DI GCAATG 1 cut(s) 343
BseGI GGATG 2 cut(s) 187, 286
BseLI CCNNNNNNNGG 2 cut(s) 311, 325
BseMI GCAATG 1 cut(s) 343
BseRI GAGGAG 1 cut(s) 107
BshFI GGCC 1 cut(s) 356
BsiSI CCGG 1 cut(s) 11
BslI CCNNNNNNNGG 2 cut(s) 311, 325
BsmAI GTCTC 2 cut(s) 100, 320
BsnI GGCC 1 cut(s) 356
Bso31I GGTCTC 2 cut(s) 100, 320
Bsp143I GATC 1 cut(s) 112
BspANI GGCC 1 cut(s) 356
BspTNI GGTCTC 2 cut(s) 100, 320
BsrDI GCAATG 1 cut(s) 343
BssMI GATC 1 cut(s) 112
Bst6I CTCTTC 1 cut(s) 98
BstAPI GCANNNNNTGC 1 cut(s) 221
BstC8I GCNNGC 1 cut(s) 217
BstF5I GGATG 2 cut(s) 187, 286
BstKTI GATC 1 cut(s) 115
BstMAI GTCTC 2 cut(s) 100, 320
BstMBI GATC 1 cut(s) 112
BstMWI GCNNNNNNNGC 2 cut(s) 11, 221
BstNSI RCATGY 1 cut(s) 204
BsuRI GGCC 1 cut(s) 356
BtsCI GGATG 2 cut(s) 187, 286
BtsIMutI CAGTG 1 cut(s) 370
Cac8I GCNNGC 1 cut(s) 217
Csp6I GTAC 1 cut(s) 344
CviAII CATG 1 cut(s) 201
CviJI RGCY 4 cut(s) 14, 219, 356, 378
CviKI_1 RGCY 4 cut(s) 14, 219, 356, 378
CviQI GTAC 1 cut(s) 344
DpnI GATC 1 cut(s) 114
DpnII GATC 1 cut(s) 112
EaeI YGGCCR 1 cut(s) 354
Eam1104I CTCTTC 1 cut(s) 98
EarI CTCTTC 1 cut(s) 98
Eco31I GGTCTC 2 cut(s) 100, 320
FaeI CATG 1 cut(s) 204
FaiI YATR 1 cut(s) 202
FatI CATG 1 cut(s) 200
FokI GGATG 2 cut(s) 194, 293
FspBI CTAG 2 cut(s) 321, 379
HaeIII GGCC 1 cut(s) 356
HapII CCGG 1 cut(s) 11
Hin1II CATG 1 cut(s) 204
HincII GTYRAC 1 cut(s) 87
HindII GTYRAC 1 cut(s) 87
HinfI GANTC 2 cut(s) 7, 174
HpaII CCGG 1 cut(s) 11
HphI GGTGA 1 cut(s) 226
Hpy166II GTNNAC 4 cut(s) 87, 143, 272, 368
Hpy188I TCNGA 1 cut(s) 66
Hpy188III TCNNGA 1 cut(s) 244
Hpy8I GTNNAC 4 cut(s) 87, 143, 272, 368
HpyCH4V TGCA 3 cut(s) 125, 153, 200
HpyF10VI GCNNNNNNNGC 2 cut(s) 11, 221
Hsp92II CATG 1 cut(s) 204
Kzo9I GATC 1 cut(s) 112
LpnPI CCDG 5 cut(s) 24, 39, 132, 201, 219
LweI GCATC 3 cut(s) 172, 182, 271
MaeI CTAG 2 cut(s) 321, 379
MaeIII GTNAC 2 cut(s) 127, 254
MalI GATC 1 cut(s) 114
MboI GATC 1 cut(s) 112
MboII GAAGA 2 cut(s) 65, 115
MluCI AATT 2 cut(s) 42, 238
MmeI TCCRAC 1 cut(s) 30
MnlI CCTC 5 cut(s) 85, 88, 240, 271, 334
MseI TTAA 2 cut(s) 210, 309
MspI CCGG 1 cut(s) 11
MwoI GCNNNNNNNGC 2 cut(s) 11, 221
NdeII GATC 1 cut(s) 112
NlaIII CATG 1 cut(s) 204
NmuCI GTSAC 1 cut(s) 254
NspI RCATGY 1 cut(s) 204
PfeI GAWTC 2 cut(s) 7, 174
RsaI GTAC 1 cut(s) 345
RsaNI GTAC 1 cut(s) 344
SaqAI TTAA 2 cut(s) 210, 309
Sau3AI GATC 1 cut(s) 112
SetI ASST 5 cut(s) 28, 121, 151, 345, 380
SfaNI GCATC 3 cut(s) 172, 182, 271
Sse9I AATT 2 cut(s) 42, 238
SspMI CTAG 2 cut(s) 321, 379
TaqI TCGA 2 cut(s) 190, 243
TasI AATT 2 cut(s) 42, 238
TfiI GAWTC 2 cut(s) 7, 174
Tru1I TTAA 2 cut(s) 210, 309
Tru9I TTAA 2 cut(s) 210, 309
TscAI CASTG 1 cut(s) 370
TseFI GTSAC 1 cut(s) 254
Tsp45I GTSAC 1 cut(s) 254
TspRI CASTG 1 cut(s) 370
XceI RCATGY 1 cut(s) 204
XspI CTAG 2 cut(s) 321, 379
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.