pycom12g16260

Phosphoinositide phosphatase

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
Physical Location & Seq
Reverse (-)
18652528 .. 18653314
787 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12g16260.2

Sequence Viewer

Length: 228 bp
ATGGCAATAGACTTAACAGATAAACATGGCGATGAAGGTCAACTAAGCACGGCATTTTTCTGCCGAAATGCAAAATCTACCAAACGTGAGGTTACAATTTGCATATTTATCAGATACGTTTCATTTGACTTTCATCATGCATGTGGTAACTCAAACTTTGAAAACCTAAAGGTTCTATACGAGCAGATCGATCACAGCATTTTGAAAAGCAAGGATACTTCCTCGTAG

Protein Analysis

76

Amino Acids

8.57

Weight (kDa)

6.39

Isoelectric Point (pI)

17.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029427)

Species Orthologous Gene IDs
pyrus_communis pycom12g10990 pycom12g16260

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 161, 205
BceAI ACGGC 1 cut(s) 66
BciVI GTATCC 1 cut(s) 208
BfuI GTATCC 1 cut(s) 208
Bsa29I ATCGAT 1 cut(s) 189
BseCI ATCGAT 1 cut(s) 189
BshVI ATCGAT 1 cut(s) 189
Bsp143I GATC 2 cut(s) 186, 190
BspDI ATCGAT 1 cut(s) 189
BssMI GATC 2 cut(s) 186, 190
BstDEI CTNAG 1 cut(s) 44
BstKTI GATC 2 cut(s) 189, 193
BstMBI GATC 2 cut(s) 186, 190
BstNSI RCATGY 1 cut(s) 144
Bsu15I ATCGAT 1 cut(s) 189
BsuI GTATCC 1 cut(s) 208
BsuTUI ATCGAT 1 cut(s) 189
BtgZI GCGATG 1 cut(s) 45
ClaI ATCGAT 1 cut(s) 189
CviAII CATG 3 cut(s) 26, 137, 141
DdeI CTNAG 1 cut(s) 44
DpnI GATC 2 cut(s) 188, 192
DpnII GATC 2 cut(s) 186, 190
EcoT22I ATGCAT 1 cut(s) 142
FaeI CATG 3 cut(s) 29, 140, 144
FaiI YATR 5 cut(s) 27, 104, 138, 142, 178
FatI CATG 3 cut(s) 25, 136, 140
Hin1II CATG 3 cut(s) 29, 140, 144
HincII GTYRAC 1 cut(s) 41
HindII GTYRAC 1 cut(s) 41
Hpy166II GTNNAC 1 cut(s) 41
Hpy188I TCNGA 1 cut(s) 113
Hpy8I GTNNAC 1 cut(s) 41
HpyAV CCTTC 1 cut(s) 29
HpyCH4IV ACGT 2 cut(s) 85, 117
HpyCH4V TGCA 3 cut(s) 71, 102, 140
HpyF3I CTNAG 1 cut(s) 44
HpySE526I ACGT 2 cut(s) 85, 117
Hsp92II CATG 3 cut(s) 29, 140, 144
Kzo9I GATC 2 cut(s) 186, 190
MaeII ACGT 2 cut(s) 85, 117
MaeIII GTNAC 2 cut(s) 91, 146
MalI GATC 2 cut(s) 188, 192
MboI GATC 2 cut(s) 186, 190
MluCI AATT 1 cut(s) 96
MnlI CCTC 1 cut(s) 82
Mph1103I ATGCAT 1 cut(s) 142
MseI TTAA 1 cut(s) 14
MslI CAYNNNNRTG 2 cut(s) 30, 141
NdeII GATC 2 cut(s) 186, 190
NlaIII CATG 3 cut(s) 29, 140, 144
NsiI ATGCAT 1 cut(s) 142
NspI RCATGY 1 cut(s) 144
PcsI WCGNNNNNNNCGW 1 cut(s) 186
RseI CAYNNNNRTG 2 cut(s) 30, 141
SaqAI TTAA 1 cut(s) 14
Sau3AI GATC 2 cut(s) 186, 190
SetI ASST 6 cut(s) 40, 88, 93, 120, 168, 174
SgeI CNNG 7 cut(s) 38, 61, 98, 149, 153, 193, 223
SmiMI CAYNNNNRTG 2 cut(s) 30, 141
Sse9I AATT 1 cut(s) 96
TaiI ACGT 2 cut(s) 88, 120
TaqI TCGA 1 cut(s) 189
TasI AATT 1 cut(s) 96
Tru1I TTAA 1 cut(s) 14
Tru9I TTAA 1 cut(s) 14
TspDTI ATGAA 3 cut(s) 48, 111, 122
XceI RCATGY 1 cut(s) 144
Zsp2I ATGCAT 1 cut(s) 142
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.