pycom13g22730

Protein of unknown function (DUF3223)

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
Physical Location & Seq
Reverse (-)
20536714 .. 20537028
315 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 315 bp
ATGGACAAATGTTCAAATGGAGAGCTATCTATTGTAAAAGTAACAAAAACTGTGATGGTGGAATGGATTAAATCCATGAAAGTGCAACAAAGAAAGGGTAAATCTGAGAAGGGTTTAACTGACGACCAGTCTTTTATACTTGACAATGTTATGAATTATCAGCCGGATAAAGCTGTTAAAATGTGTTTTGGAATCGGTCGTCGCACAACATGTTTATTTACGCTGTTCTTGTTTAACTGCAAACAACTGCGTTTTATTATTATGTTTCAGTTTAGGTTTGATGGCATGAATATTTGTTACATCACACTAACTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

105

Amino Acids

12.16

Weight (kDa)

9.37

Isoelectric Point (pI)

26.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022522)

Species Orthologous Gene IDs
pyrus_communis pycom01g13750 pycom02g25690 pycom07g02770 pycom13g22730

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflIII ACRYGT 1 cut(s) 209
AgsI TTSAA 1 cut(s) 15
AhdI GACNNNNNGTC 1 cut(s) 127
AluBI AGCT 2 cut(s) 25, 173
AluI AGCT 2 cut(s) 25, 173
BccI CCATC 2 cut(s) 49, 275
BmeRI GACNNNNNGTC 1 cut(s) 127
Bse1I ACTGG 1 cut(s) 127
BseMII CTCAG 1 cut(s) 96
BseNI ACTGG 1 cut(s) 127
Bsh1285I CGRYCG 1 cut(s) 199
BsiEI CGRYCG 1 cut(s) 199
BsiSI CCGG 1 cut(s) 164
BspCNI CTCAG 1 cut(s) 97
BsrI ACTGG 1 cut(s) 127
Bst4CI ACNGT 1 cut(s) 52
BstDEI CTNAG 1 cut(s) 105
BstMCI CGRYCG 1 cut(s) 199
BstNSI RCATGY 1 cut(s) 213
CviAII CATG 3 cut(s) 76, 210, 286
CviJI RGCY 3 cut(s) 25, 163, 173
CviKI_1 RGCY 3 cut(s) 25, 163, 173
DdeI CTNAG 1 cut(s) 105
DriI GACNNNNNGTC 1 cut(s) 127
Eam1105I GACNNNNNGTC 1 cut(s) 127
FaeI CATG 3 cut(s) 79, 213, 289
FaiI YATR 6 cut(s) 77, 137, 152, 211, 263, 287
FatI CATG 3 cut(s) 75, 209, 285
HapII CCGG 1 cut(s) 164
Hin1II CATG 3 cut(s) 79, 213, 289
HinfI GANTC 1 cut(s) 192
HpaII CCGG 1 cut(s) 164
Hpy188I TCNGA 1 cut(s) 106
Hpy99I CGWCG 1 cut(s) 204
HpyAV CCTTC 1 cut(s) 103
HpyCH4III ACNGT 1 cut(s) 52
HpyCH4V TGCA 2 cut(s) 85, 240
HpyF3I CTNAG 1 cut(s) 105
Hsp92II CATG 3 cut(s) 79, 213, 289
LpnPI CCDG 2 cut(s) 140, 177
MaeIII GTNAC 2 cut(s) 40, 296
MluCI AATT 1 cut(s) 154
MseI TTAA 5 cut(s) 69, 116, 177, 234, 313
MslI CAYNNNNRTG 1 cut(s) 80
MspI CCGG 1 cut(s) 164
NlaIII CATG 3 cut(s) 79, 213, 289
NspI RCATGY 1 cut(s) 213
PciI ACATGT 1 cut(s) 209
PfeI GAWTC 1 cut(s) 192
PscI ACATGT 1 cut(s) 209
RseI CAYNNNNRTG 1 cut(s) 80
SaqAI TTAA 5 cut(s) 69, 116, 177, 234, 313
SetI ASST 3 cut(s) 27, 175, 278
SgeI CNNG 7 cut(s) 88, 139, 152, 176, 222, 241, 298
SmiMI CAYNNNNRTG 1 cut(s) 80
Sse9I AATT 1 cut(s) 154
SspI AATATT 1 cut(s) 292
TaaI ACNGT 1 cut(s) 52
TaqII GACCGA 1 cut(s) 185
TasI AATT 1 cut(s) 154
TfiI GAWTC 1 cut(s) 192
Tru1I TTAA 5 cut(s) 69, 116, 177, 234, 313
Tru9I TTAA 5 cut(s) 69, 116, 177, 234, 313
TspDTI ATGAA 3 cut(s) 92, 167, 302
XceI RCATGY 1 cut(s) 213
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.