pycom15g06120

xyloglucan glycosyltransferase

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
Physical Location & Seq
Forward (+)
3738816 .. 3739031
216 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom15g06120.1

Sequence Viewer

Length: 216 bp
ATGAAGGAAGAAATTAGACAGCAGGAGCAAAGGGCTTCCAGGAAAAAGAAGCACAACAGAATATACACAAAGGAGTTGGCATTGGCTTTCCTCCTTCTAACTGCTGCGGCGAGGAGCCTTCTGTCTGCTCAGGGTATCCACTTCTACTTCTTGTTGTTTCAGGGAGTATCGTTCCTGCTGGTCGGTTTAGACCTAATTGGCGAACAGGTAGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

72

Amino Acids

8.18

Weight (kDa)

9.6

Isoelectric Point (pI)

42.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029341)

Species Orthologous Gene IDs
pyrus_communis pycom08g06390 pycom15g06120

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 107
AjnI CCWGG 1 cut(s) 38
ApeKI GCWGC 1 cut(s) 104
BbvI GCAGC 1 cut(s) 91
BciT130I CCWGG 1 cut(s) 40
BciVI GTATCC 1 cut(s) 146
BfuI GTATCC 1 cut(s) 146
BisI GCNGC 2 cut(s) 105, 108
BlsI GCNGC 2 cut(s) 106, 109
Bme1390I CCNGG 1 cut(s) 40
BmiI GGNNCC 1 cut(s) 116
BmrFI CCNGG 1 cut(s) 40
Bpu10I CCTNAGC 1 cut(s) 129
BseBI CCWGG 1 cut(s) 40
BseMII CTCAG 1 cut(s) 143
BseRI GAGGAG 1 cut(s) 127
BseXI GCAGC 1 cut(s) 91
BspACI CCGC 1 cut(s) 107
BspCNI CTCAG 1 cut(s) 142
BspLI GGNNCC 1 cut(s) 116
Bst2UI CCWGG 1 cut(s) 40
BstDEI CTNAG 1 cut(s) 129
BstNI CCWGG 1 cut(s) 40
BstSCI CCNGG 1 cut(s) 38
BstV1I GCAGC 1 cut(s) 91
BsuI GTATCC 1 cut(s) 146
CviJI RGCY 3 cut(s) 35, 86, 117
CviKI_1 RGCY 3 cut(s) 35, 86, 117
DdeI CTNAG 1 cut(s) 129
EcoRII CCWGG 1 cut(s) 38
FaiI YATR 1 cut(s) 64
Fnu4HI GCNGC 2 cut(s) 105, 108
Fsp4HI GCNGC 2 cut(s) 105, 108
GluI GCNGC 2 cut(s) 105, 108
HpyAV CCTTC 2 cut(s) 104, 128
HpyF3I CTNAG 1 cut(s) 129
LmnI GCTCC 2 cut(s) 25, 114
LpnPI CCDG 8 cut(s) 8, 25, 52, 116, 146, 164, 188, 191
Lsp1109I GCAGC 1 cut(s) 91
MboII GAAGA 1 cut(s) 20
MluCI AATT 2 cut(s) 12, 195
MnlI CCTC 2 cut(s) 101, 105
MspR9I CCNGG 1 cut(s) 40
MvaI CCWGG 1 cut(s) 40
NlaIV GGNNCC 1 cut(s) 116
PfoI TCCNGGA 1 cut(s) 38
PkrI GCNGC 2 cut(s) 106, 109
Psp6I CCWGG 1 cut(s) 38
PspGI CCWGG 1 cut(s) 38
PspN4I GGNNCC 1 cut(s) 116
SatI GCNGC 2 cut(s) 105, 108
ScrFI CCNGG 1 cut(s) 40
SetI ASST 2 cut(s) 195, 210
SgeI CNNG 9 cut(s) 35, 51, 52, 123, 143, 163, 173, 187, 191
Sse9I AATT 2 cut(s) 12, 195
SsiI CCGC 1 cut(s) 107
StyD4I CCNGG 1 cut(s) 38
TasI AATT 2 cut(s) 12, 195
TauI GCSGC 1 cut(s) 110
TseI GCWGC 1 cut(s) 104
TspDTI ATGAA 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.