pycom15g09470

Belongs to the universal ribosomal protein uS3 family

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
Physical Location & Seq
Reverse (-)
6183332 .. 6183749
418 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom15g09470.1

Sequence Viewer

Length: 225 bp
ATGTTTCTCCCAAGTTGCATTGCTCTTTTTCTCTCTCGGTTACACATTGATGGAAAAGAAATAGCATGTGTGGAATGGATCCAAGAAAGTAGAGTTCCTCTACAAATCATTCGAGTCAAACTGATCATTGTTCCTCCAAAATTCCCCATTCCCCCAAGAAACCCCAATTCCTTCCTCTCAATCCCCTCTCTGATCCTACGATTAATTCCAATTCCGTCATCTTGA

Protein Analysis

75

Amino Acids

8.38

Weight (kDa)

9.84

Isoelectric Point (pI)

66.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0026712)

Species Orthologous Gene IDs
pyrus_communis pycom15g09470
rosa_rugosa RorugPtG0000300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 73, 86, 187
AcsI RAATTY 1 cut(s) 140
AlwI GGATC 3 cut(s) 73, 86, 187
ApoI RAATTY 1 cut(s) 140
AseI ATTAAT 1 cut(s) 203
BamHI GGATCC 1 cut(s) 78
BccI CCATC 1 cut(s) 44
BclI TGATCA 1 cut(s) 123
BmiI GGNNCC 1 cut(s) 80
Bse3DI GCAATG 1 cut(s) 18
BseMI GCAATG 1 cut(s) 18
Bsp143I GATC 3 cut(s) 78, 123, 192
BspLI GGNNCC 1 cut(s) 80
BspPI GGATC 3 cut(s) 73, 86, 187
BsrDI GCAATG 1 cut(s) 18
BssMI GATC 3 cut(s) 78, 123, 192
BstKTI GATC 3 cut(s) 81, 126, 195
BstMBI GATC 3 cut(s) 78, 123, 192
BstNSI RCATGY 1 cut(s) 69
BstX2I RGATCY 1 cut(s) 78
BstYI RGATCY 1 cut(s) 78
CviAII CATG 1 cut(s) 66
DpnI GATC 3 cut(s) 80, 125, 194
DpnII GATC 3 cut(s) 78, 123, 192
FaeI CATG 1 cut(s) 69
FaiI YATR 1 cut(s) 67
FatI CATG 1 cut(s) 65
FbaI TGATCA 1 cut(s) 123
Hin1II CATG 1 cut(s) 69
HinfI GANTC 1 cut(s) 114
Hpy188I TCNGA 1 cut(s) 192
Hpy188III TCNNGA 1 cut(s) 222
HpyAV CCTTC 1 cut(s) 181
HpyCH4V TGCA 1 cut(s) 18
Hsp92II CATG 1 cut(s) 69
Ksp22I TGATCA 1 cut(s) 123
Kzo9I GATC 3 cut(s) 78, 123, 192
MaeIII GTNAC 1 cut(s) 39
MalI GATC 3 cut(s) 80, 125, 194
MboI GATC 3 cut(s) 78, 123, 192
MflI RGATCY 1 cut(s) 78
MluCI AATT 4 cut(s) 140, 166, 204, 210
MlyI GAGTC 1 cut(s) 123
MnlI CCTC 4 cut(s) 108, 144, 185, 196
MseI TTAA 1 cut(s) 203
MslI CAYNNNNRTG 1 cut(s) 48
NdeII GATC 3 cut(s) 78, 123, 192
NlaIII CATG 1 cut(s) 69
NlaIV GGNNCC 1 cut(s) 80
NspI RCATGY 1 cut(s) 69
PleI GAGTC 1 cut(s) 122
PpsI GAGTC 1 cut(s) 122
PshBI ATTAAT 1 cut(s) 203
PspN4I GGNNCC 1 cut(s) 80
PsuI RGATCY 1 cut(s) 78
RseI CAYNNNNRTG 1 cut(s) 48
SaqAI TTAA 1 cut(s) 203
Sau3AI GATC 3 cut(s) 78, 123, 192
SchI GAGTC 1 cut(s) 123
SgeI CNNG 6 cut(s) 24, 48, 78, 95, 125, 168
SmiMI CAYNNNNRTG 1 cut(s) 48
Sse9I AATT 4 cut(s) 140, 166, 204, 210
TaqI TCGA 1 cut(s) 112
TasI AATT 4 cut(s) 140, 166, 204, 210
Tru1I TTAA 1 cut(s) 203
Tru9I TTAA 1 cut(s) 203
TspGWI ACGGA 1 cut(s) 204
VspI ATTAAT 1 cut(s) 203
XapI RAATTY 1 cut(s) 140
XceI RCATGY 1 cut(s) 69
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.