pycom15g23730

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
Physical Location & Seq
Forward (+)
17884218 .. 17884409
192 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 192 bp
ATGGAGCTTCTTGTCATGAGTGGTGCTTGTCGGCTGATTGTGGGTCGGAGGATCCATGAGTATATGTTGAAGGTGGGATTAACGGGGAATTCGCAGGTTACGAATGCACAACTGAGCTTGAAGCATGGTGGTGTTGCTAGTGCCATAGCAAGTAAAGCATTGGTGCTTGAGATTTGTGATCCTATCATGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

64

Amino Acids

6.71

Weight (kDa)

8.8

Isoelectric Point (pI)

34.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024352)

Species Orthologous Gene IDs
malus_domestica MD16G1155900.v1.1
pyrus_communis pycom03g13570 pycom15g23730

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 85
AclWI GGATC 3 cut(s) 46, 59, 173
AcsI RAATTY 1 cut(s) 88
AgsI TTSAA 2 cut(s) 70, 121
AluBI AGCT 2 cut(s) 7, 117
AluI AGCT 2 cut(s) 7, 117
AlwI GGATC 3 cut(s) 46, 59, 173
ApoI RAATTY 1 cut(s) 88
BamHI GGATCC 1 cut(s) 51
BfaI CTAG 1 cut(s) 138
BfuAI ACCTGC 1 cut(s) 85
BmiI GGNNCC 1 cut(s) 53
BpuEI CTTGAG 1 cut(s) 188
BseMII CTCAG 1 cut(s) 104
BsmI GAATGC 1 cut(s) 109
Bsp143I GATC 2 cut(s) 51, 178
BspCNI CTCAG 1 cut(s) 105
BspHI TCATGA 1 cut(s) 15
BspLI GGNNCC 1 cut(s) 53
BspMI ACCTGC 1 cut(s) 85
BspPI GGATC 3 cut(s) 46, 59, 173
BssMI GATC 2 cut(s) 51, 178
BstDEI CTNAG 1 cut(s) 113
BstKTI GATC 2 cut(s) 54, 181
BstMBI GATC 2 cut(s) 51, 178
BstMWI GCNNNNNNNGC 1 cut(s) 155
BstX2I RGATCY 1 cut(s) 51
BstYI RGATCY 1 cut(s) 51
BveI ACCTGC 1 cut(s) 85
CciI TCATGA 1 cut(s) 15
CviAII CATG 4 cut(s) 16, 56, 125, 187
CviJI RGCY 3 cut(s) 7, 34, 117
CviKI_1 RGCY 3 cut(s) 7, 34, 117
DdeI CTNAG 1 cut(s) 113
DpnI GATC 2 cut(s) 53, 180
DpnII GATC 2 cut(s) 51, 178
EcoRI GAATTC 1 cut(s) 88
FaeI CATG 4 cut(s) 19, 59, 128, 190
FaiI YATR 7 cut(s) 17, 57, 63, 65, 126, 146, 188
FatI CATG 4 cut(s) 15, 55, 124, 186
FspBI CTAG 1 cut(s) 138
Hin1II CATG 4 cut(s) 19, 59, 128, 190
Hpy188I TCNGA 1 cut(s) 48
Hpy188III TCNNGA 1 cut(s) 16
HpyAV CCTTC 1 cut(s) 64
HpyCH4V TGCA 1 cut(s) 107
HpyF10VI GCNNNNNNNGC 1 cut(s) 155
HpyF3I CTNAG 1 cut(s) 113
Hsp92II CATG 4 cut(s) 19, 59, 128, 190
Kzo9I GATC 2 cut(s) 51, 178
LmnI GCTCC 1 cut(s) 4
LpnPI CCDG 1 cut(s) 80
MaeI CTAG 1 cut(s) 138
MaeIII GTNAC 1 cut(s) 97
MalI GATC 2 cut(s) 53, 180
MboI GATC 2 cut(s) 51, 178
MflI RGATCY 1 cut(s) 51
MluCI AATT 1 cut(s) 88
MmeI TCCRAC 1 cut(s) 26
MnlI CCTC 1 cut(s) 42
MseI TTAA 1 cut(s) 80
MslI CAYNNNNRTG 1 cut(s) 129
Mva1269I GAATGC 1 cut(s) 109
MwoI GCNNNNNNNGC 1 cut(s) 155
NdeII GATC 2 cut(s) 51, 178
NlaIII CATG 4 cut(s) 19, 59, 128, 190
NlaIV GGNNCC 1 cut(s) 53
PagI TCATGA 1 cut(s) 15
PcsI WCGNNNNNNNCGW 1 cut(s) 98
PctI GAATGC 1 cut(s) 109
PspN4I GGNNCC 1 cut(s) 53
PsuI RGATCY 1 cut(s) 51
RseI CAYNNNNRTG 1 cut(s) 129
SaqAI TTAA 1 cut(s) 80
Sau3AI GATC 2 cut(s) 51, 178
SetI ASST 4 cut(s) 9, 75, 99, 119
SmiMI CAYNNNNRTG 1 cut(s) 129
SmlI CTYRAG 1 cut(s) 167
SmoI CTYRAG 1 cut(s) 167
Sse9I AATT 1 cut(s) 88
SspMI CTAG 1 cut(s) 138
TasI AATT 1 cut(s) 88
Tru1I TTAA 1 cut(s) 80
Tru9I TTAA 1 cut(s) 80
XapI RAATTY 1 cut(s) 88
XspI CTAG 1 cut(s) 138
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.