pycom15g26590

Isocitrate dehydrogenase NADP

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
Physical Location & Seq
Reverse (-)
21533191 .. 21533585
395 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom15g26590.2

Sequence Viewer

Length: 288 bp
ATGTGGGAAGTGCTCAATACGTGTCCAATTTACAGGTTGGAAGAAAGCCATGTGTATTTGCAGGCATGCCTTTGGCGATTAGTATCGAGCCTGATACAGTTGTCAAAAGGCCATGAAAACTTGAAATGGTTTTTGATAAGAGTCTCCCATGTTGCACTTGATGTTTACAATTTCAAAGGGCCTGGTGTGGCCCTTTCTGTGTATAATGTTGATGAGGTTTATGCTACGACAATGGGCATCGCATACCTTTTTGTTCGTTTAGGCAAATGTGCTGATAAACTCTACTAA

Protein Analysis

96

Amino Acids

10.97

Weight (kDa)

7.73

Isoelectric Point (pI)

16.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022538)

Species Orthologous Gene IDs
pyrus_communis pycom04g02640 pycom15g26590 pycom15g31240 pycom16g18660

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflIII ACRYGT 1 cut(s) 20
AgsI TTSAA 2 cut(s) 124, 175
AjnI CCWGG 1 cut(s) 181
Alw21I GWGCWC 1 cut(s) 15
Alw26I GTCTC 1 cut(s) 148
AoxI GGCC 3 cut(s) 109, 179, 189
AspS9I GGNCC 2 cut(s) 179, 190
BaeI ACNNNNGTAYC 2 cut(s) 86, 119
Bbv12I GWGCWC 1 cut(s) 15
BciT130I CCWGG 1 cut(s) 183
BcoDI GTCTC 1 cut(s) 148
Bme1390I CCNGG 1 cut(s) 183
BmgT120I GGNCC 2 cut(s) 179, 190
BmrFI CCNGG 1 cut(s) 183
BmsI GCATC 1 cut(s) 246
BsaAI YACGTR 1 cut(s) 21
BsaBI GATNNNNATC 1 cut(s) 82
Bse8I GATNNNNATC 1 cut(s) 82
BseBI CCWGG 1 cut(s) 183
BseJI GATNNNNATC 1 cut(s) 82
BshFI GGCC 3 cut(s) 111, 181, 191
BsiHKAI GWGCWC 1 cut(s) 15
BsmAI GTCTC 1 cut(s) 148
BsnI GGCC 3 cut(s) 111, 181, 191
Bsp1286I GDGCHC 1 cut(s) 15
BspANI GGCC 3 cut(s) 111, 181, 191
Bst2UI CCWGG 1 cut(s) 183
Bst4CI ACNGT 1 cut(s) 99
BstBAI YACGTR 1 cut(s) 21
BstC8I GCNNGC 2 cut(s) 63, 67
BstMAI GTCTC 1 cut(s) 148
BstNI CCWGG 1 cut(s) 183
BstNSI RCATGY 1 cut(s) 69
BstSCI CCNGG 1 cut(s) 181
BsuRI GGCC 3 cut(s) 111, 181, 191
BtgZI GCGATG 1 cut(s) 223
Cac8I GCNNGC 2 cut(s) 63, 67
Cfr13I GGNCC 2 cut(s) 179, 190
CviAII CATG 4 cut(s) 50, 66, 113, 149
CviJI RGCY 5 cut(s) 48, 90, 111, 181, 191
CviKI_1 RGCY 5 cut(s) 48, 90, 111, 181, 191
EcoO109I RGGNCCY 1 cut(s) 179
EcoRII CCWGG 1 cut(s) 181
FaeI CATG 4 cut(s) 53, 69, 116, 152
FaiI YATR 7 cut(s) 51, 67, 114, 150, 204, 222, 244
FatI CATG 4 cut(s) 49, 65, 112, 148
HaeIII GGCC 3 cut(s) 111, 181, 191
Hin1II CATG 4 cut(s) 53, 69, 116, 152
HinfI GANTC 1 cut(s) 141
Hpy166II GTNNAC 1 cut(s) 166
Hpy8I GTNNAC 1 cut(s) 166
HpyCH4III ACNGT 1 cut(s) 99
HpyCH4IV ACGT 1 cut(s) 20
HpyCH4V TGCA 2 cut(s) 61, 155
HpySE526I ACGT 1 cut(s) 20
Hsp92II CATG 4 cut(s) 53, 69, 116, 152
LpnPI CCDG 5 cut(s) 19, 47, 104, 168, 195
LweI GCATC 1 cut(s) 246
MaeII ACGT 1 cut(s) 20
MboII GAAGA 1 cut(s) 53
MhlI GDGCHC 1 cut(s) 15
MluCI AATT 2 cut(s) 27, 169
MlyI GAGTC 1 cut(s) 150
MmeI TCCRAC 1 cut(s) 18
MnlI CCTC 1 cut(s) 208
MspR9I CCNGG 1 cut(s) 183
MvaI CCWGG 1 cut(s) 183
NlaIII CATG 4 cut(s) 53, 69, 116, 152
NspI RCATGY 1 cut(s) 69
PaeI GCATGC 1 cut(s) 69
PleI GAGTC 1 cut(s) 149
PpsI GAGTC 1 cut(s) 149
Ppu21I YACGTR 1 cut(s) 21
Psp6I CCWGG 1 cut(s) 181
PspGI CCWGG 1 cut(s) 181
PspPI GGNCC 2 cut(s) 179, 190
Sau96I GGNCC 2 cut(s) 179, 190
SchI GAGTC 1 cut(s) 150
ScrFI CCNGG 1 cut(s) 183
SduI GDGCHC 1 cut(s) 15
SetI ASST 4 cut(s) 23, 38, 219, 249
SfaNI GCATC 1 cut(s) 246
SphI GCATGC 1 cut(s) 69
Sse9I AATT 2 cut(s) 27, 169
StyD4I CCNGG 1 cut(s) 181
TaaI ACNGT 1 cut(s) 99
TaiI ACGT 1 cut(s) 23
TaqI TCGA 1 cut(s) 86
TasI AATT 2 cut(s) 27, 169
TspDTI ATGAA 1 cut(s) 129
XceI RCATGY 1 cut(s) 69
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.