pycom15g38230

TMV resistance protein N-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
Physical Location & Seq
Forward (+)
38064382 .. 38065518
1137 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 186 bp
ATGGTTTTTCCAGTTTTTTACAAGGTGGATCCATCGGATGTGAGGAACCAAAGAGAGAGTTTCGGTGAGGCACTTGCTGACCATGAACGCAAGTTCAAAGATAACATGGACAAGGTGTTGAGATGGAGAGAAACTCTTACAAAAGCAGCAAATTTGTCTGGGTGGTCATTCCTGGTGGACGGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

62

Amino Acids

7.15

Weight (kDa)

6.55

Isoelectric Point (pI)

28.97

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TIR PF01582 2 - 56 1.1e-11 TIR domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024702)

Species Orthologous Gene IDs
pyrus_communis pycom15g38230
rosa_chinensis RchiOBHm_Chr6g0261881
rosa_rugosa Rorug07G0158900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 23, 36
AcsI RAATTY 1 cut(s) 151
AgsI TTSAA 1 cut(s) 97
AjnI CCWGG 1 cut(s) 171
AlwI GGATC 2 cut(s) 23, 36
ApeKI GCWGC 1 cut(s) 146
ApoI RAATTY 1 cut(s) 151
AsuHPI GGTGA 1 cut(s) 77
BamHI GGATCC 1 cut(s) 28
BbvI GCAGC 1 cut(s) 158
BccI CCATC 2 cut(s) 40, 117
BciT130I CCWGG 1 cut(s) 173
BisI GCNGC 1 cut(s) 147
BlsI GCNGC 1 cut(s) 148
Bme1390I CCNGG 1 cut(s) 173
BmiI GGNNCC 2 cut(s) 30, 47
BmrFI CCNGG 1 cut(s) 173
BplI GAGNNNNNCTC 2 cut(s) 118, 150
Bse1I ACTGG 1 cut(s) 11
BseBI CCWGG 1 cut(s) 173
BseGI GGATG 1 cut(s) 43
BseNI ACTGG 1 cut(s) 11
BseXI GCAGC 1 cut(s) 158
Bsp143I GATC 1 cut(s) 28
BspLI GGNNCC 2 cut(s) 30, 47
BspPI GGATC 2 cut(s) 23, 36
BsrI ACTGG 1 cut(s) 11
BssMI GATC 1 cut(s) 28
Bst2UI CCWGG 1 cut(s) 173
BstF5I GGATG 1 cut(s) 43
BstKTI GATC 1 cut(s) 31
BstMBI GATC 1 cut(s) 28
BstNI CCWGG 1 cut(s) 173
BstSCI CCNGG 1 cut(s) 171
BstV1I GCAGC 1 cut(s) 158
BstX2I RGATCY 1 cut(s) 28
BstYI RGATCY 1 cut(s) 28
BtsCI GGATG 1 cut(s) 43
CviAII CATG 2 cut(s) 83, 106
CviJI RGCY 1 cut(s) 183
CviKI_1 RGCY 1 cut(s) 183
DpnI GATC 1 cut(s) 30
DpnII GATC 1 cut(s) 28
EcoRII CCWGG 1 cut(s) 171
FaeI CATG 2 cut(s) 86, 109
FaiI YATR 2 cut(s) 84, 107
FatI CATG 2 cut(s) 82, 105
Fnu4HI GCNGC 1 cut(s) 147
FokI GGATG 1 cut(s) 50
Fsp4HI GCNGC 1 cut(s) 147
GluI GCNGC 1 cut(s) 147
Hin1II CATG 2 cut(s) 86, 109
HphI GGTGA 1 cut(s) 77
Hpy166II GTNNAC 1 cut(s) 178
Hpy188I TCNGA 1 cut(s) 37
Hpy8I GTNNAC 1 cut(s) 178
Hsp92II CATG 2 cut(s) 86, 109
Kzo9I GATC 1 cut(s) 28
LpnPI CCDG 3 cut(s) 24, 144, 158
Lsp1109I GCAGC 1 cut(s) 158
MalI GATC 1 cut(s) 30
MboI GATC 1 cut(s) 28
MflI RGATCY 1 cut(s) 28
MluCI AATT 1 cut(s) 151
MnlI CCTC 2 cut(s) 36, 61
MspR9I CCNGG 1 cut(s) 173
MvaI CCWGG 1 cut(s) 173
NdeII GATC 1 cut(s) 28
NlaIII CATG 2 cut(s) 86, 109
NlaIV GGNNCC 2 cut(s) 30, 47
PkrI GCNGC 1 cut(s) 148
Psp6I CCWGG 1 cut(s) 171
PspGI CCWGG 1 cut(s) 171
PspN4I GGNNCC 2 cut(s) 30, 47
PsuI RGATCY 1 cut(s) 28
SatI GCNGC 1 cut(s) 147
Sau3AI GATC 1 cut(s) 28
ScrFI CCNGG 1 cut(s) 173
SetI ASST 2 cut(s) 27, 117
SgeI CNNG 8 cut(s) 23, 34, 86, 95, 103, 118, 124, 171
Sse9I AATT 1 cut(s) 151
StyD4I CCNGG 1 cut(s) 171
TasI AATT 1 cut(s) 151
TseI GCWGC 1 cut(s) 146
TspDTI ATGAA 1 cut(s) 99
XapI RAATTY 1 cut(s) 151
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.