pycom15g39170

Phd finger protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
Physical Location & Seq
Reverse (-)
38895769 .. 38896070
302 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom15g39170.1

Sequence Viewer

Length: 183 bp
ATGGAGGGCATACCGCACCCAATACCTCGAACAGTGGAGGAAGTCTTCAGCGACTTCAGAGGCAGACGCGCCGGCTTGATTAAGGCCCTCACCAATGACGTTCAGAAATTTTATCAACTGTGCGATCCTGGTGAGTTCTCTTTTCTTTTTCTTTTTTTTACGTTTATGTTCTCTTTCTTTTGA

Protein Analysis

61

Amino Acids

7.09

Weight (kDa)

5.62

Isoelectric Point (pI)

23.55

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Alfin PF12165 11 - 44 2.3e-11 Alfin
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024703)

Species Orthologous Gene IDs
pyrus_communis pycom15g39170
rosa_chinensis RchiOBHm_Chr3g0479081
rosa_samantha Rh7AG319900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 69
AciI CCGC 1 cut(s) 14
AclWI GGATC 1 cut(s) 119
AcsI RAATTY 1 cut(s) 107
AcuI CTGAAG 2 cut(s) 31, 40
AjnI CCWGG 1 cut(s) 127
AlwI GGATC 1 cut(s) 119
AoxI GGCC 1 cut(s) 84
ApoI RAATTY 1 cut(s) 107
AspLEI GCGC 1 cut(s) 71
AspS9I GGNCC 1 cut(s) 85
AsuHPI GGTGA 2 cut(s) 82, 143
BbsI GAAGAC 1 cut(s) 37
BciT130I CCWGG 1 cut(s) 129
Bme1390I CCNGG 1 cut(s) 129
BmgT120I GGNCC 1 cut(s) 85
BmrFI CCNGG 1 cut(s) 129
BpiI GAAGAC 1 cut(s) 37
Bse118I RCCGGY 1 cut(s) 71
BseBI CCWGG 1 cut(s) 129
Bsh1236I CGCG 1 cut(s) 69
BshFI GGCC 1 cut(s) 86
BsiSI CCGG 1 cut(s) 72
BsnI GGCC 1 cut(s) 86
Bsp143I GATC 1 cut(s) 124
BspACI CCGC 1 cut(s) 14
BspANI GGCC 1 cut(s) 86
BspFNI CGCG 1 cut(s) 69
BspPI GGATC 1 cut(s) 119
BsrFI RCCGGY 1 cut(s) 71
BssAI RCCGGY 1 cut(s) 71
BssMI GATC 1 cut(s) 124
Bst2UI CCWGG 1 cut(s) 129
Bst4CI ACNGT 2 cut(s) 34, 120
BstC8I GCNNGC 1 cut(s) 73
BstFNI CGCG 1 cut(s) 69
BstHHI GCGC 1 cut(s) 71
BstKTI GATC 1 cut(s) 127
BstMBI GATC 1 cut(s) 124
BstNI CCWGG 1 cut(s) 129
BstSCI CCNGG 1 cut(s) 127
BstUI CGCG 1 cut(s) 69
BstV2I GAAGAC 1 cut(s) 37
BsuRI GGCC 1 cut(s) 86
BtsIMutI CAGTG 1 cut(s) 39
Cac8I GCNNGC 1 cut(s) 73
CfoI GCGC 1 cut(s) 71
Cfr10I RCCGGY 1 cut(s) 71
Cfr13I GGNCC 1 cut(s) 85
CseI GACGC 1 cut(s) 75
CviJI RGCY 2 cut(s) 75, 86
CviKI_1 RGCY 2 cut(s) 75, 86
DpnI GATC 1 cut(s) 126
DpnII GATC 1 cut(s) 124
Eco57I CTGAAG 2 cut(s) 31, 40
EcoO109I RGGNCCY 1 cut(s) 85
EcoRII CCWGG 1 cut(s) 127
FaiI YATR 2 cut(s) 11, 167
GlaI GCGC 1 cut(s) 70
HaeIII GGCC 1 cut(s) 86
HapII CCGG 1 cut(s) 72
HgaI GACGC 1 cut(s) 75
HhaI GCGC 1 cut(s) 71
Hin6I GCGC 1 cut(s) 69
HinP1I GCGC 1 cut(s) 69
HpaII CCGG 1 cut(s) 72
HphI GGTGA 2 cut(s) 82, 143
Hpy188I TCNGA 2 cut(s) 59, 105
HpyCH4III ACNGT 2 cut(s) 34, 120
HpyCH4IV ACGT 2 cut(s) 99, 161
HpySE526I ACGT 2 cut(s) 99, 161
HspAI GCGC 1 cut(s) 69
KroI GCCGGC 1 cut(s) 71
KroNI GCCGGC 1 cut(s) 73
Kzo9I GATC 1 cut(s) 124
LpnPI CCDG 3 cut(s) 85, 114, 141
MaeII ACGT 2 cut(s) 99, 161
MalI GATC 1 cut(s) 126
MboI GATC 1 cut(s) 124
MboII GAAGA 1 cut(s) 37
MluCI AATT 1 cut(s) 107
MnlI CCTC 4 cut(s) 31, 36, 53, 98
MroNI GCCGGC 1 cut(s) 71
MseI TTAA 1 cut(s) 81
MspI CCGG 1 cut(s) 72
MspR9I CCNGG 1 cut(s) 129
MvaI CCWGG 1 cut(s) 129
MvnI CGCG 1 cut(s) 69
NaeI GCCGGC 1 cut(s) 73
NdeII GATC 1 cut(s) 124
NgoMIV GCCGGC 1 cut(s) 71
PdiI GCCGGC 1 cut(s) 73
Psp6I CCWGG 1 cut(s) 127
PspGI CCWGG 1 cut(s) 127
PspPI GGNCC 1 cut(s) 85
SaqAI TTAA 1 cut(s) 81
Sau3AI GATC 1 cut(s) 124
Sau96I GGNCC 1 cut(s) 85
ScrFI CCNGG 1 cut(s) 129
SetI ASST 3 cut(s) 28, 102, 164
SgeI CNNG 6 cut(s) 39, 80, 84, 88, 140, 141
Sse9I AATT 1 cut(s) 107
SsiI CCGC 1 cut(s) 14
StyD4I CCNGG 1 cut(s) 127
TaaI ACNGT 2 cut(s) 34, 120
TaiI ACGT 2 cut(s) 102, 164
TaqI TCGA 1 cut(s) 28
TasI AATT 1 cut(s) 107
Tru1I TTAA 1 cut(s) 81
Tru9I TTAA 1 cut(s) 81
TscAI CASTG 1 cut(s) 39
TspRI CASTG 1 cut(s) 39
XapI RAATTY 1 cut(s) 107
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.