pycom16g11800

C-terminal binding protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
Physical Location & Seq
Reverse (-)
8221496 .. 8221741
246 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom16g11800.1

Sequence Viewer

Length: 246 bp
ATGCCGACCTTGGGATCTAGCTTACCCACATGGACGCACCGCGTGCCAAGGAGATTGCGGACATGGATGTGGCACTTTTCTCCGCCAAACGCACATGCTTTCTTTCCACGTACTATGGCTTCGAGATGGGTCCGCTCGCGCCAGCCGCTGTGCCGTGGGATGAGATGGTATCGAGGCTTGGTTTTGGGGATTATCGGCAGATCTGAGCTGGCTCTGTCTCTACCTACAAGGAAACCCCAAATCTAA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

82

Amino Acids

9.57

Weight (kDa)

12.0

Isoelectric Point (pI)

73.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029474)

Species Orthologous Gene IDs
pyrus_communis pycom16g11800
rosa_samantha Rh1DG269200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 135
AccII CGCG 2 cut(s) 42, 139
AciI CCGC 5 cut(s) 40, 58, 83, 133, 146
AclWI GGATC 1 cut(s) 22
AdeI CACNNNGTG 1 cut(s) 43
AfaI GTAC 1 cut(s) 112
AfiI CCNNNNNNNGG 1 cut(s) 11
AluBI AGCT 2 cut(s) 21, 208
AluI AGCT 2 cut(s) 21, 208
Alw26I GTCTC 1 cut(s) 222
AlwI GGATC 1 cut(s) 22
AlwNI CAGNNNCTG 1 cut(s) 148
AspLEI GCGC 1 cut(s) 141
AspS9I GGNCC 1 cut(s) 130
AvaII GGWCC 1 cut(s) 130
BarI GAAGNNNNNNTAC 2 cut(s) 103, 135
BccI CCATC 2 cut(s) 120, 159
BceAI ACGGC 1 cut(s) 138
BcoDI GTCTC 1 cut(s) 222
BfaI CTAG 1 cut(s) 18
BglII AGATCT 1 cut(s) 200
BisI GCNGC 1 cut(s) 146
BlsI GCNGC 1 cut(s) 147
Bme18I GGWCC 1 cut(s) 130
BmgT120I GGNCC 1 cut(s) 130
BmiI GGNNCC 1 cut(s) 131
BsaAI YACGTR 1 cut(s) 110
BsaJI CCNNGG 3 cut(s) 9, 47, 154
Bsc4I CCNNNNNNNGG 1 cut(s) 11
BseDI CCNNGG 3 cut(s) 9, 47, 154
BseGI GGATG 2 cut(s) 72, 165
BseLI CCNNNNNNNGG 1 cut(s) 11
BseMII CTCAG 1 cut(s) 195
Bsh1236I CGCG 2 cut(s) 42, 139
BslI CCNNNNNNNGG 1 cut(s) 11
BsmAI GTCTC 1 cut(s) 222
Bsp143I GATC 2 cut(s) 14, 200
BspACI CCGC 5 cut(s) 40, 58, 83, 133, 146
BspCNI CTCAG 1 cut(s) 196
BspFNI CGCG 2 cut(s) 42, 139
BspLI GGNNCC 1 cut(s) 131
BspPI GGATC 1 cut(s) 22
BsrBI CCGCTC 1 cut(s) 135
BssECI CCNNGG 3 cut(s) 9, 47, 154
BssMI GATC 2 cut(s) 14, 200
BssT1I CCWWGG 2 cut(s) 9, 47
BstAPI GCANNNNNTGC 1 cut(s) 43
BstBAI YACGTR 1 cut(s) 110
BstC8I GCNNGC 4 cut(s) 44, 137, 143, 210
BstDEI CTNAG 1 cut(s) 204
BstDSI CCRYGG 1 cut(s) 154
BstF5I GGATG 2 cut(s) 72, 165
BstFNI CGCG 2 cut(s) 42, 139
BstHHI GCGC 1 cut(s) 141
BstKTI GATC 2 cut(s) 17, 203
BstMAI GTCTC 1 cut(s) 222
BstMBI GATC 2 cut(s) 14, 200
BstMWI GCNNNNNNNGC 2 cut(s) 43, 145
BstNSI RCATGY 1 cut(s) 98
BstUI CGCG 2 cut(s) 42, 139
BstX2I RGATCY 2 cut(s) 14, 200
BstYI RGATCY 2 cut(s) 14, 200
BtgI CCRYGG 1 cut(s) 154
BtsCI GGATG 2 cut(s) 72, 165
Cac8I GCNNGC 4 cut(s) 44, 137, 143, 210
CaiI CAGNNNCTG 1 cut(s) 148
CfoI GCGC 1 cut(s) 141
Cfr13I GGNCC 1 cut(s) 130
CseI GACGC 1 cut(s) 43
Csp6I GTAC 1 cut(s) 111
CviAII CATG 3 cut(s) 30, 63, 95
CviJI RGCY 6 cut(s) 21, 119, 145, 177, 208, 212
CviKI_1 RGCY 6 cut(s) 21, 119, 145, 177, 208, 212
CviQI GTAC 1 cut(s) 111
DdeI CTNAG 1 cut(s) 204
DpnI GATC 2 cut(s) 16, 202
DpnII GATC 2 cut(s) 14, 200
DraIII CACNNNGTG 1 cut(s) 43
EciI GGCGGA 1 cut(s) 72
Eco130I CCWWGG 2 cut(s) 9, 47
Eco47I GGWCC 1 cut(s) 130
EcoT14I CCWWGG 2 cut(s) 9, 47
ErhI CCWWGG 2 cut(s) 9, 47
FaeI CATG 3 cut(s) 33, 66, 98
FaiI YATR 4 cut(s) 31, 64, 96, 116
FatI CATG 3 cut(s) 29, 62, 94
Fnu4HI GCNGC 1 cut(s) 146
FokI GGATG 2 cut(s) 79, 172
Fsp4HI GCNGC 1 cut(s) 146
FspBI CTAG 1 cut(s) 18
GlaI GCGC 1 cut(s) 140
GluI GCNGC 1 cut(s) 146
HgaI GACGC 1 cut(s) 43
HhaI GCGC 1 cut(s) 141
Hin1II CATG 3 cut(s) 33, 66, 98
Hin6I GCGC 1 cut(s) 139
HinP1I GCGC 1 cut(s) 139
Hpy188I TCNGA 1 cut(s) 205
Hpy188III TCNNGA 1 cut(s) 123
HpyCH4IV ACGT 1 cut(s) 109
HpyF10VI GCNNNNNNNGC 2 cut(s) 43, 145
HpyF3I CTNAG 1 cut(s) 204
HpySE526I ACGT 1 cut(s) 109
Hsp92II CATG 3 cut(s) 33, 66, 98
HspAI GCGC 1 cut(s) 139
Kzo9I GATC 2 cut(s) 14, 200
LpnPI CCDG 2 cut(s) 155, 194
MaeI CTAG 1 cut(s) 18
MaeII ACGT 1 cut(s) 109
MalI GATC 2 cut(s) 16, 202
MbiI CCGCTC 1 cut(s) 135
MboI GATC 2 cut(s) 14, 200
MflI RGATCY 2 cut(s) 14, 200
MnlI CCTC 1 cut(s) 167
MslI CAYNNNNRTG 1 cut(s) 67
MspA1I CMGCKG 1 cut(s) 148
MvnI CGCG 2 cut(s) 42, 139
MwoI GCNNNNNNNGC 2 cut(s) 43, 145
NdeII GATC 2 cut(s) 14, 200
NlaIII CATG 3 cut(s) 33, 66, 98
NlaIV GGNNCC 1 cut(s) 131
NspI RCATGY 1 cut(s) 98
PkrI GCNGC 1 cut(s) 147
Ppu21I YACGTR 1 cut(s) 110
PspN4I GGNNCC 1 cut(s) 131
PspPI GGNCC 1 cut(s) 130
PstNI CAGNNNCTG 1 cut(s) 148
PsuI RGATCY 2 cut(s) 14, 200
RsaI GTAC 1 cut(s) 112
RsaNI GTAC 1 cut(s) 111
RseI CAYNNNNRTG 1 cut(s) 67
SatI GCNGC 1 cut(s) 146
Sau3AI GATC 2 cut(s) 14, 200
Sau96I GGNCC 1 cut(s) 130
SetI ASST 5 cut(s) 11, 23, 112, 210, 226
SinI GGWCC 1 cut(s) 130
SmiMI CAYNNNNRTG 1 cut(s) 67
SsiI CCGC 5 cut(s) 40, 58, 83, 133, 146
SspMI CTAG 1 cut(s) 18
StyI CCWWGG 2 cut(s) 9, 47
TaiI ACGT 1 cut(s) 112
TaqI TCGA 2 cut(s) 122, 172
TauI GCSGC 1 cut(s) 148
VpaK11BI GGWCC 1 cut(s) 130
XceI RCATGY 1 cut(s) 98
XspI CTAG 1 cut(s) 18
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.