pycom17g12020

UDP-Glycosyltransferase

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
Physical Location & Seq
Reverse (-)
9793918 .. 9794331
414 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom17g12020.1

Sequence Viewer

Length: 414 bp
ATGCTTAAATTAGCTTCAGCCTTCCTTAGCCAAGGCTTCAAGCCAGTGATGGTCACTCCAGACTACATTCACCACCAGATTGTCCGAAAAGTCGAACCCAAGGAAAAGATTTTGTGCATGCCAATCTCGGATGGATTGGACAAGGACACCCCGAGGGACTTCTTTGCCATCGAGAAGGCCATGGAGGACAACATGCCAAGCCATCTGGAAAGCCTTGTCCGTCAACTTGATAAGGATGGTGATGAAGTTGTGTGCGTTGTTGTTGATTTGTTGGCATCGTGGGCTATAGATGTAGCCAATCGATGCGGAGTAGCCTGTGCTGGGTTTTGGCCTGCTATGCATGCCACTTATCGCTTGATCACTGCAATTCCAGACATGATCAGGACAGGTCTCATTTGTGCTGATACAGGTTAG
Functional Annotation

Protein Analysis

138

Amino Acids

15.19

Weight (kDa)

5.24

Isoelectric Point (pI)

25.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029487)

Species Orthologous Gene IDs
pyrus_communis pycom17g12020
rosa_multiflora Rmu_co8197110.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 306
AfiI CCNNNNNNNGG 1 cut(s) 321
AgsI TTSAA 1 cut(s) 40
AluBI AGCT 1 cut(s) 14
AluI AGCT 1 cut(s) 14
Alw26I GTCTC 1 cut(s) 395
Ama87I CYCGRG 1 cut(s) 151
AoxI GGCC 2 cut(s) 177, 329
AsuHPI GGTGA 2 cut(s) 62, 251
AvaI CYCGRG 1 cut(s) 151
BccI CCATC 5 cut(s) 43, 125, 176, 210, 230
BclI TGATCA 2 cut(s) 357, 378
BcoDI GTCTC 1 cut(s) 395
BfmI CTRYAG 1 cut(s) 285
BmeT110I CYCGRG 1 cut(s) 151
BmsI GCATC 2 cut(s) 284, 293
BpmI CTGGAG 1 cut(s) 42
Bpu10I CCTNAGC 1 cut(s) 26
Bsa29I ATCGAT 1 cut(s) 301
BsaI GGTCTC 1 cut(s) 395
BsaJI CCNNGG 4 cut(s) 31, 99, 152, 180
Bsc4I CCNNNNNNNGG 1 cut(s) 321
Bse1I ACTGG 1 cut(s) 44
BseCI ATCGAT 1 cut(s) 301
BseDI CCNNGG 4 cut(s) 31, 99, 152, 180
BseGI GGATG 2 cut(s) 136, 241
BseLI CCNNNNNNNGG 1 cut(s) 321
BseNI ACTGG 1 cut(s) 44
BseYI CCCAGC 1 cut(s) 320
BshFI GGCC 2 cut(s) 179, 331
BshVI ATCGAT 1 cut(s) 301
BsiHKCI CYCGRG 1 cut(s) 151
BslFI GGGAC 1 cut(s) 170
BslI CCNNNNNNNGG 1 cut(s) 321
BsmAI GTCTC 1 cut(s) 395
BsmFI GGGAC 1 cut(s) 170
BsnI GGCC 2 cut(s) 179, 331
Bso31I GGTCTC 1 cut(s) 395
BsoBI CYCGRG 1 cut(s) 151
Bsp143I GATC 2 cut(s) 357, 378
Bsp19I CCATGG 1 cut(s) 180
BspACI CCGC 1 cut(s) 306
BspANI GGCC 2 cut(s) 179, 331
BspDI ATCGAT 1 cut(s) 301
BspTNI GGTCTC 1 cut(s) 395
BsrI ACTGG 1 cut(s) 44
BssECI CCNNGG 4 cut(s) 31, 99, 152, 180
BssMI GATC 2 cut(s) 357, 378
BssT1I CCWWGG 3 cut(s) 31, 99, 180
BstC8I GCNNGC 3 cut(s) 119, 333, 342
BstDEI CTNAG 1 cut(s) 26
BstDSI CCRYGG 1 cut(s) 180
BstF5I GGATG 2 cut(s) 136, 241
BstKTI GATC 2 cut(s) 360, 381
BstMAI GTCTC 1 cut(s) 395
BstMBI GATC 2 cut(s) 357, 378
BstMWI GCNNNNNNNGC 3 cut(s) 281, 337, 341
BstNSI RCATGY 3 cut(s) 121, 196, 344
BstSFI CTRYAG 1 cut(s) 285
Bsu15I ATCGAT 1 cut(s) 301
BsuRI GGCC 2 cut(s) 179, 331
BsuTUI ATCGAT 1 cut(s) 301
BtgI CCRYGG 1 cut(s) 180
BtsCI GGATG 2 cut(s) 136, 241
BtsI GCAGTG 1 cut(s) 360
BtsIMutI CAGTG 2 cut(s) 51, 360
Cac8I GCNNGC 3 cut(s) 119, 333, 342
ClaI ATCGAT 1 cut(s) 301
CviAII CATG 5 cut(s) 118, 181, 193, 341, 376
DdeI CTNAG 1 cut(s) 26
DpnI GATC 2 cut(s) 359, 380
DpnII GATC 2 cut(s) 357, 378
Eco130I CCWWGG 3 cut(s) 31, 99, 180
Eco31I GGTCTC 1 cut(s) 395
Eco88I CYCGRG 1 cut(s) 151
EcoT14I CCWWGG 3 cut(s) 31, 99, 180
EcoT22I ATGCAT 1 cut(s) 342
ErhI CCWWGG 3 cut(s) 31, 99, 180
FaeI CATG 5 cut(s) 121, 184, 196, 344, 379
FaiI YATR 7 cut(s) 119, 182, 194, 287, 338, 342, 377
FaqI GGGAC 1 cut(s) 170
FatI CATG 5 cut(s) 117, 180, 192, 340, 375
FbaI TGATCA 2 cut(s) 357, 378
FokI GGATG 2 cut(s) 143, 248
GsaI CCCAGC 1 cut(s) 324
GsuI CTGGAG 1 cut(s) 42
HaeIII GGCC 2 cut(s) 179, 331
Hin1II CATG 5 cut(s) 121, 184, 196, 344, 379
HincII GTYRAC 1 cut(s) 224
HindII GTYRAC 1 cut(s) 224
HphI GGTGA 2 cut(s) 62, 251
Hpy166II GTNNAC 1 cut(s) 224
Hpy188I TCNGA 2 cut(s) 86, 130
Hpy188III TCNNGA 5 cut(s) 59, 172, 206, 371, 382
Hpy8I GTNNAC 1 cut(s) 224
HpyAV CCTTC 2 cut(s) 31, 169
HpyCH4V TGCA 3 cut(s) 117, 340, 365
HpyF10VI GCNNNNNNNGC 3 cut(s) 281, 337, 341
HpyF3I CTNAG 1 cut(s) 26
Hsp92II CATG 5 cut(s) 121, 184, 196, 344, 379
Ksp22I TGATCA 2 cut(s) 357, 378
Kzo9I GATC 2 cut(s) 357, 378
LweI GCATC 2 cut(s) 284, 293
MaeIII GTNAC 1 cut(s) 52
MalI GATC 2 cut(s) 359, 380
MboI GATC 2 cut(s) 357, 378
MluCI AATT 2 cut(s) 8, 366
MnlI CCTC 2 cut(s) 147, 178
Mph1103I ATGCAT 1 cut(s) 342
MseI TTAA 1 cut(s) 6
MwoI GCNNNNNNNGC 3 cut(s) 281, 337, 341
NcoI CCATGG 1 cut(s) 180
NdeII GATC 2 cut(s) 357, 378
NlaIII CATG 5 cut(s) 121, 184, 196, 344, 379
NmuCI GTSAC 1 cut(s) 52
NsiI ATGCAT 1 cut(s) 342
NspI RCATGY 3 cut(s) 121, 196, 344
PaeI GCATGC 2 cut(s) 121, 344
PspFI CCCAGC 1 cut(s) 320
SaqAI TTAA 1 cut(s) 6
Sau3AI GATC 2 cut(s) 357, 378
SetI ASST 3 cut(s) 16, 391, 412
SfaNI GCATC 2 cut(s) 284, 293
SfcI CTRYAG 1 cut(s) 285
SphI GCATGC 2 cut(s) 121, 344
Sse9I AATT 2 cut(s) 8, 366
SsiI CCGC 1 cut(s) 306
StyI CCWWGG 3 cut(s) 31, 99, 180
TaqI TCGA 3 cut(s) 93, 171, 301
TasI AATT 2 cut(s) 8, 366
Tru1I TTAA 1 cut(s) 6
Tru9I TTAA 1 cut(s) 6
TscAI CASTG 2 cut(s) 51, 367
TseFI GTSAC 1 cut(s) 52
Tsp45I GTSAC 1 cut(s) 52
TspDTI ATGAA 1 cut(s) 258
TspGWI ACGGA 1 cut(s) 209
TspRI CASTG 2 cut(s) 51, 367
XceI RCATGY 3 cut(s) 121, 196, 344
Zsp2I ATGCAT 1 cut(s) 342
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.