Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8197110.1

Orthogroup ID

OG0029487

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 368

Gene Structure 367 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8197110.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 367 bp

atgaagtgcataaagaggaggtccaaaaccatcatcctggttccatatccggctcagggacatgtaactcctatgcttaagttagcctccgccttcctcagccacggctttgatccggtgctggtcataccggactacattcaccgccagattgtcccaaaaatcgaatccaaagacaagattcaatgcatgccaatcccggacgggttggacaaggacgccccgagggacttcttcaccatcgagaaggccatggaacacaacatgcctgttcatttagagaaacttgttcatcatctggatgaagatggaggtgttgtgtgcatagtcattgatttgcttgcgtcgtgggctatagaagtagcca

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0008194 GO:0016740 GO:0016757 GO:0016758 GO:0035251 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464 GO:0046527 GO:0080043 GO:0080044

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

UDPGT

Protein Analysis

122

Amino Acids

13.75

Weight (kDa)

6.36

Isoelectric Point (pI)

48.81

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0029487)

Species	Orthologous Gene IDs
pyrus_communis	pycom17g12020
rosa_multiflora	Rmu_co8197110.1_g000001

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	90, 145
AclWI	GGATC	1 cut(s)	107
AcyI	GRCGYC	1 cut(s)	219
AfiI	CCNNNNNNNGG	1 cut(s)	56
AflII	CTTAAG	1 cut(s)	77
AflIII	ACRYGT	1 cut(s)	61
AgsI	TTSAA	1 cut(s)	185
AjnI	CCWGG	1 cut(s)	36
AlwI	GGATC	1 cut(s)	107
Ama87I	CYCGRG	1 cut(s)	223
AoxI	GGCC	1 cut(s)	249
AspS9I	GGNCC	1 cut(s)	21
AsuC2I	CCSGG	1 cut(s)	200
AsuHPI	GGTGA	2 cut(s)	134, 229
AvaI	CYCGRG	1 cut(s)	223
AvaII	GGWCC	1 cut(s)	21
BbvCI	CCTCAGC	1 cut(s)	98
BccI	CCATC	3 cut(s)	38, 248, 302
BceAI	ACGGC	1 cut(s)	121
BciT130I	CCWGG	1 cut(s)	38
BcnI	CCSGG	1 cut(s)	200
BfmI	CTRYAG	1 cut(s)	354
BfrI	CTTAAG	1 cut(s)	77
Bme1390I	CCNGG	2 cut(s)	38, 200
Bme18I	GGWCC	1 cut(s)	21
BmeT110I	CYCGRG	1 cut(s)	223
BmgT120I	GGNCC	1 cut(s)	21
BmiI	GGNNCC	1 cut(s)	42
BmrFI	CCNGG	2 cut(s)	38, 200
Bpu10I	CCTNAGC	2 cut(s)	54, 98
BpuMI	CCSGG	1 cut(s)	200
BsaHI	GRCGYC	1 cut(s)	219
BsaJI	CCNNGG	3 cut(s)	103, 224, 252
BsaWI	WCCGGW	2 cut(s)	115, 130
BsaXI	ACNNNNNCTCC	2 cut(s)	303, 333
Bsc4I	CCNNNNNNNGG	1 cut(s)	56
BseBI	CCWGG	1 cut(s)	38
BseDI	CCNNGG	3 cut(s)	103, 224, 252
BseGI	GGATG	2 cut(s)	33, 307
BseLI	CCNNNNNNNGG	1 cut(s)	56
BseMII	CTCAG	2 cut(s)	68, 112
BseRI	GAGGAG	1 cut(s)	31
BshFI	GGCC	1 cut(s)	251
BsiHKCI	CYCGRG	1 cut(s)	223
BsiSI	CCGG	4 cut(s)	50, 116, 131, 200
BslFI	GGGAC	3 cut(s)	72, 140, 242
BslI	CCNNNNNNNGG	1 cut(s)	56
BsmFI	GGGAC	3 cut(s)	72, 140, 242
BsnI	GGCC	1 cut(s)	251
BsoBI	CYCGRG	1 cut(s)	223
Bsp143I	GATC	1 cut(s)	112
Bsp19I	CCATGG	1 cut(s)	252
BspACI	CCGC	2 cut(s)	90, 145
BspANI	GGCC	1 cut(s)	251
BspCNI	CTCAG	2 cut(s)	67, 111
BspLI	GGNNCC	1 cut(s)	42
BspPI	GGATC	1 cut(s)	107
BspTI	CTTAAG	1 cut(s)	77
BssECI	CCNNGG	3 cut(s)	103, 224, 252
BssMI	GATC	1 cut(s)	112
BssNI	GRCGYC	1 cut(s)	219
BssT1I	CCWWGG	1 cut(s)	252
Bst2UI	CCWGG	1 cut(s)	38
BstACI	GRCGYC	1 cut(s)	219
BstAFI	CTTAAG	1 cut(s)	77
BstC8I	GCNNGC	2 cut(s)	191, 342
BstDEI	CTNAG	2 cut(s)	54, 98
BstDSI	CCRYGG	2 cut(s)	103, 252
BstF5I	GGATG	2 cut(s)	33, 307
BstKTI	GATC	1 cut(s)	115
BstMBI	GATC	1 cut(s)	112
BstMWI	GCNNNNNNNGC	1 cut(s)	350
BstNI	CCWGG	1 cut(s)	38
BstNSI	RCATGY	3 cut(s)	65, 193, 268
BstSCI	CCNGG	2 cut(s)	36, 198
BstSFI	CTRYAG	1 cut(s)	354
BstXI	CCANNNNNNTGG	1 cut(s)	37
BsuRI	GGCC	1 cut(s)	251
BtgI	CCRYGG	2 cut(s)	103, 252
BtsCI	GGATG	2 cut(s)	33, 307
Cac8I	GCNNGC	2 cut(s)	191, 342
Cfr13I	GGNCC	1 cut(s)	21
CseI	GACGC	2 cut(s)	227, 333
CviAII	CATG	4 cut(s)	62, 190, 253, 265
CviJI	RGCY	7 cut(s)	53, 86, 102, 108, 251, 353, 365
CviKI_1	RGCY	7 cut(s)	53, 86, 102, 108, 251, 353, 365
DdeI	CTNAG	2 cut(s)	54, 98
DpnI	GATC	1 cut(s)	114
DpnII	GATC	1 cut(s)	112
EciI	GGCGGA	1 cut(s)	79
Eco130I	CCWWGG	1 cut(s)	252
Eco47I	GGWCC	1 cut(s)	21
Eco88I	CYCGRG	1 cut(s)	223
EcoRII	CCWGG	1 cut(s)	36
EcoT14I	CCWWGG	1 cut(s)	252
EcoT22I	ATGCAT	1 cut(s)	191
ErhI	CCWWGG	1 cut(s)	252
FaeI	CATG	4 cut(s)	65, 193, 256, 268
FaqI	GGGAC	3 cut(s)	72, 140, 242
FatI	CATG	4 cut(s)	61, 189, 252, 264
FokI	GGATG	2 cut(s)	20, 314
HaeIII	GGCC	1 cut(s)	251
HapII	CCGG	4 cut(s)	50, 116, 131, 200
HgaI	GACGC	2 cut(s)	227, 333
Hin1I	GRCGYC	1 cut(s)	219
Hin1II	CATG	4 cut(s)	65, 193, 256, 268
HinfI	GANTC	2 cut(s)	167, 181
HpaII	CCGG	4 cut(s)	50, 116, 131, 200
HphI	GGTGA	2 cut(s)	134, 229
Hpy188III	TCNNGA	2 cut(s)	244, 299
Hpy99I	CGWCG	1 cut(s)	349
HpyAV	CCTTC	2 cut(s)	103, 241
HpyCH4V	TGCA	3 cut(s)	9, 189, 324
HpyF10VI	GCNNNNNNNGC	1 cut(s)	350
HpyF3I	CTNAG	2 cut(s)	54, 98
Hsp92I	GRCGYC	1 cut(s)	219
Hsp92II	CATG	4 cut(s)	65, 193, 256, 268
Kzo9I	GATC	1 cut(s)	112
MaeIII	GTNAC	1 cut(s)	64
MalI	GATC	1 cut(s)	114
MboI	GATC	1 cut(s)	112
MboII	GAAGA	2 cut(s)	226, 317
MmeI	TCCRAC	1 cut(s)	189
MnlI	CCTC	6 cut(s)	9, 12, 97, 107, 219, 305
Mph1103I	ATGCAT	1 cut(s)	191
MseI	TTAA	1 cut(s)	78
MslI	CAYNNNNRTG	1 cut(s)	300
MspCI	CTTAAG	1 cut(s)	77
MspI	CCGG	4 cut(s)	50, 116, 131, 200
MspR9I	CCNGG	2 cut(s)	38, 200
MvaI	CCWGG	1 cut(s)	38
MwoI	GCNNNNNNNGC	1 cut(s)	350
NciI	CCSGG	1 cut(s)	200
NcoI	CCATGG	1 cut(s)	252
NdeII	GATC	1 cut(s)	112
NlaIII	CATG	4 cut(s)	65, 193, 256, 268
NlaIV	GGNNCC	1 cut(s)	42
NsiI	ATGCAT	1 cut(s)	191
NspI	RCATGY	3 cut(s)	65, 193, 268
PaeI	GCATGC	1 cut(s)	193
PciI	ACATGT	1 cut(s)	61
PfeI	GAWTC	2 cut(s)	167, 181
PfoI	TCCNGGA	1 cut(s)	198
PscI	ACATGT	1 cut(s)	61
Psp6I	CCWGG	1 cut(s)	36
PspGI	CCWGG	1 cut(s)	36
PspN4I	GGNNCC	1 cut(s)	42
PspPI	GGNCC	1 cut(s)	21
RseI	CAYNNNNRTG	1 cut(s)	300
SaqAI	TTAA	1 cut(s)	78
Sau3AI	GATC	1 cut(s)	112
Sau96I	GGNCC	1 cut(s)	21
ScrFI	CCNGG	2 cut(s)	38, 200
SetI	ASST	2 cut(s)	23, 316
SfcI	CTRYAG	1 cut(s)	354
SinI	GGWCC	1 cut(s)	21
SmiMI	CAYNNNNRTG	1 cut(s)	300
SmlI	CTYRAG	1 cut(s)	77
SmoI	CTYRAG	1 cut(s)	77
SphI	GCATGC	1 cut(s)	193
SsiI	CCGC	2 cut(s)	90, 145
StyD4I	CCNGG	2 cut(s)	36, 198
StyI	CCWWGG	1 cut(s)	252
TaqI	TCGA	2 cut(s)	165, 243
TfiI	GAWTC	2 cut(s)	167, 181
Tru1I	TTAA	1 cut(s)	78
Tru9I	TTAA	1 cut(s)	78
TspDTI	ATGAA	4 cut(s)	17, 263, 281, 318
Vha464I	CTTAAG	1 cut(s)	77
VpaK11BI	GGWCC	1 cut(s)	21
XceI	RCATGY	3 cut(s)	65, 193, 268
Zsp2I	ATGCAT	1 cut(s)	191

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.