pycom17g26900

AarF domain-containing protein kinase

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
Physical Location & Seq
Forward (+)
25189753 .. 25190731
979 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom17g26900.4

Sequence Viewer

Length: 408 bp
ATGTCAGTTGAAGAAAAAAGTAATCTAAAGCAAGAGTTGAAGTCCCTAAAGATGGAGGACATATCTTCATTCATGGAATCCTTGCCATCTGACTTCCTCACAATATTGCGTACTGATGGGCTACTTAGGTCCATCGTTAGCAAGTTGGGTGCTCCACAAAGAGTGAGGTTACTAGCCTATGGAAAATGTGCATTATATGGTCTTTCTCCAAAGTTGAATCCTGAATCTGATTTTTCTGTGAAAGTGAAATTATCGCGATTGAAGGCAAAAGTGAGCTACCTTTGGTTAAGGCTTATTCTCGCGGTAATCGAGCTCCGTTTGCAGTTGGGAAAGGTCAAGCTTCTTCTGCACACTTTGTATGAAAAGATGGGTGGTGCTATGAGGAGAATTTTGCTTGTTTCCTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

136

Amino Acids

15.26

Weight (kDa)

10.0

Isoelectric Point (pI)

54.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029495)

Species Orthologous Gene IDs
pyrus_communis pycom17g26900
rosa_samantha Rh3CG343000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 2 cut(s) 256, 302
AciI CCGC 1 cut(s) 302
AcsI RAATTY 1 cut(s) 387
AfaI GTAC 1 cut(s) 112
AfiI CCNNNNNNNGG 1 cut(s) 52
AgsI TTSAA 4 cut(s) 11, 40, 217, 262
AluBI AGCT 3 cut(s) 276, 313, 340
AluI AGCT 3 cut(s) 276, 313, 340
Alw21I GWGCWC 2 cut(s) 154, 315
ApoI RAATTY 1 cut(s) 387
AspS9I GGNCC 1 cut(s) 129
AvaII GGWCC 1 cut(s) 129
BanII GRGCYC 1 cut(s) 315
Bbv12I GWGCWC 2 cut(s) 154, 315
BccI CCATC 5 cut(s) 46, 94, 110, 140, 361
BfaI CTAG 1 cut(s) 173
Bme18I GGWCC 1 cut(s) 129
BmgT120I GGNCC 1 cut(s) 129
Bsc4I CCNNNNNNNGG 1 cut(s) 52
BseLI CCNNNNNNNGG 1 cut(s) 52
BseRI GAGGAG 1 cut(s) 397
BsgI GTGCAG 1 cut(s) 332
Bsh1236I CGCG 2 cut(s) 256, 302
BsiHKAI GWGCWC 2 cut(s) 154, 315
BslFI GGGAC 1 cut(s) 28
BslI CCNNNNNNNGG 1 cut(s) 52
BsmFI GGGAC 1 cut(s) 28
Bsp1286I GDGCHC 2 cut(s) 154, 315
Bsp68I TCGCGA 1 cut(s) 256
BspACI CCGC 1 cut(s) 302
BspFNI CGCG 2 cut(s) 256, 302
BstDEI CTNAG 1 cut(s) 125
BstFNI CGCG 2 cut(s) 256, 302
BstMWI GCNNNNNNNGC 2 cut(s) 319, 346
BstUI CGCG 2 cut(s) 256, 302
BtuMI TCGCGA 1 cut(s) 256
Cfr13I GGNCC 1 cut(s) 129
Csp6I GTAC 1 cut(s) 111
CviAII CATG 1 cut(s) 73
CviJI RGCY 6 cut(s) 121, 176, 276, 292, 313, 340
CviKI_1 RGCY 6 cut(s) 121, 176, 276, 292, 313, 340
CviQI GTAC 1 cut(s) 111
DdeI CTNAG 1 cut(s) 125
Ecl136II GAGCTC 1 cut(s) 313
Eco24I GRGCYC 1 cut(s) 315
Eco47I GGWCC 1 cut(s) 129
Eco53kI GAGCTC 1 cut(s) 313
EcoICRI GAGCTC 1 cut(s) 313
EcoT38I GRGCYC 1 cut(s) 315
FaeI CATG 1 cut(s) 76
FaiI YATR 7 cut(s) 62, 74, 180, 196, 198, 360, 380
FaqI GGGAC 1 cut(s) 28
FatI CATG 1 cut(s) 72
FriOI GRGCYC 1 cut(s) 315
FspBI CTAG 1 cut(s) 173
Hin1II CATG 1 cut(s) 76
HindIII AAGCTT 1 cut(s) 338
HinfI GANTC 3 cut(s) 77, 217, 224
Hpy188I TCNGA 2 cut(s) 91, 229
Hpy188III TCNNGA 3 cut(s) 221, 255, 405
HpyAV CCTTC 1 cut(s) 256
HpyCH4V TGCA 3 cut(s) 191, 322, 349
HpyF10VI GCNNNNNNNGC 2 cut(s) 319, 346
HpyF3I CTNAG 1 cut(s) 125
Hsp92II CATG 1 cut(s) 76
LmnI GCTCC 2 cut(s) 157, 318
LpnPI CCDG 1 cut(s) 234
MaeI CTAG 1 cut(s) 173
MaeIII GTNAC 1 cut(s) 168
MboII GAAGA 3 cut(s) 23, 57, 335
MhlI GDGCHC 2 cut(s) 154, 315
MluCI AATT 2 cut(s) 248, 387
MnlI CCTC 4 cut(s) 49, 107, 159, 375
MseI TTAA 1 cut(s) 287
MvnI CGCG 2 cut(s) 256, 302
MwoI GCNNNNNNNGC 2 cut(s) 319, 346
NlaIII CATG 1 cut(s) 76
NruI TCGCGA 1 cut(s) 256
PcsI WCGNNNNNNNCGW 1 cut(s) 306
PfeI GAWTC 3 cut(s) 77, 217, 224
Psp124BI GAGCTC 1 cut(s) 315
PspPI GGNCC 1 cut(s) 129
RruI TCGCGA 1 cut(s) 256
RsaI GTAC 1 cut(s) 112
RsaNI GTAC 1 cut(s) 111
SacI GAGCTC 1 cut(s) 315
SaqAI TTAA 1 cut(s) 287
Sau96I GGNCC 1 cut(s) 129
SduI GDGCHC 2 cut(s) 154, 315
SetI ASST 7 cut(s) 131, 170, 278, 282, 315, 336, 342
SinI GGWCC 1 cut(s) 129
Sse9I AATT 2 cut(s) 248, 387
SsiI CCGC 1 cut(s) 302
SspI AATATT 1 cut(s) 105
SspMI CTAG 1 cut(s) 173
SstI GAGCTC 1 cut(s) 315
TaqI TCGA 1 cut(s) 309
TasI AATT 2 cut(s) 248, 387
TfiI GAWTC 3 cut(s) 77, 217, 224
Tru1I TTAA 1 cut(s) 287
Tru9I TTAA 1 cut(s) 287
TspDTI ATGAA 3 cut(s) 57, 61, 375
TspGWI ACGGA 1 cut(s) 305
VpaK11BI GGWCC 1 cut(s) 129
XapI RAATTY 1 cut(s) 387
XspI CTAG 1 cut(s) 173
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.