RchiOBHm_Chr5g0035441

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
29319680 .. 29319948
269 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 225 bp
ATGTTTGGTTCAACTATTGAAGTAAATTCTGGATTGCAGATGATGGTCATATTCTCCTTGCTTTTCTCTAGTTTTATAGTGGAGAGGGTGGGAGAGAGAATTGGCTTAAGTTGCCTATTTGCACTCCTCTTCATTGCACTTCTTAGTACTGCCTATGAAAGTCAGTTTTGCACTTTAAGTTTGTATCTTCTCCTCTGTGTTCTTTGCTGGACTCGTATTTTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

74

Amino Acids

8.34

Weight (kDa)

4.94

Isoelectric Point (pI)

36.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022589)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0326971 RchiOBHm_Chr4g0400641 RchiOBHm_Chr5g0035441
rosa_samantha Rh2AG312900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 25
AfaI GTAC 1 cut(s) 148
AflII CTTAAG 1 cut(s) 106
AgsI TTSAA 2 cut(s) 12, 20
ApoI RAATTY 1 cut(s) 25
ArsI GACNNNNNNTTYG 1 cut(s) 202
BccI CCATC 1 cut(s) 37
BfaI CTAG 1 cut(s) 69
BfrI CTTAAG 1 cut(s) 106
BmcAI AGTACT 1 cut(s) 148
Bse3DI GCAATG 1 cut(s) 132
BseMI GCAATG 1 cut(s) 132
BseRI GAGGAG 2 cut(s) 116, 182
BspTI CTTAAG 1 cut(s) 106
BsrDI GCAATG 1 cut(s) 132
Bst6I CTCTTC 1 cut(s) 134
BstAFI CTTAAG 1 cut(s) 106
BstDEI CTNAG 1 cut(s) 143
BstMWI GCNNNNNNNGC 1 cut(s) 111
Csp6I GTAC 1 cut(s) 147
CviJI RGCY 1 cut(s) 105
CviKI_1 RGCY 1 cut(s) 105
CviQI GTAC 1 cut(s) 147
DdeI CTNAG 1 cut(s) 143
Eam1104I CTCTTC 1 cut(s) 134
EarI CTCTTC 1 cut(s) 134
FaiI YATR 3 cut(s) 50, 77, 156
FspBI CTAG 1 cut(s) 69
HinfI GANTC 1 cut(s) 211
Hpy188III TCNNGA 1 cut(s) 30
HpyCH4V TGCA 4 cut(s) 37, 122, 137, 171
HpyF10VI GCNNNNNNNGC 1 cut(s) 111
HpyF3I CTNAG 1 cut(s) 143
LpnPI CCDG 2 cut(s) 15, 193
MaeI CTAG 1 cut(s) 69
MboII GAAGA 2 cut(s) 121, 179
MluCI AATT 2 cut(s) 25, 99
MlyI GAGTC 1 cut(s) 205
MnlI CCTC 3 cut(s) 78, 137, 203
MseI TTAA 2 cut(s) 107, 176
MspCI CTTAAG 1 cut(s) 106
MwoI GCNNNNNNNGC 1 cut(s) 111
PleI GAGTC 1 cut(s) 205
PpsI GAGTC 1 cut(s) 205
RsaI GTAC 1 cut(s) 148
RsaNI GTAC 1 cut(s) 147
SaqAI TTAA 2 cut(s) 107, 176
ScaI AGTACT 1 cut(s) 148
SchI GAGTC 1 cut(s) 205
SgeI CNNG 4 cut(s) 42, 70, 81, 220
SmlI CTYRAG 1 cut(s) 106
SmoI CTYRAG 1 cut(s) 106
Sse9I AATT 2 cut(s) 25, 99
SspMI CTAG 1 cut(s) 69
TasI AATT 2 cut(s) 25, 99
TatI WGTACW 1 cut(s) 146
Tru1I TTAA 2 cut(s) 107, 176
Tru9I TTAA 2 cut(s) 107, 176
TspDTI ATGAA 2 cut(s) 121, 171
Vha464I CTTAAG 1 cut(s) 106
XapI RAATTY 1 cut(s) 25
XspI CTAG 1 cut(s) 69
ZrmI AGTACT 1 cut(s) 148
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.