RchiOBHm_Chr1g0326971

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
15537816 .. 15538895
1080 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ55654

Sequence Viewer

Length: 339 bp
ATGGTAGTTCTTCATTTTATCTGGGTGTATATTGTGCTGGGATTTTTTTTATATTATTGGATTGACTTTTCTGGAACTCAAGCAGGTCTATTTCCCACCTTTTTTTGTTTCTCTATGTTTGGTTCAACTATTAAAGTAAATTCTGGATTGCAGATGATGGTCGCATTCTCCTCGCTTTTCTCTAGTTTTATAGTGGAGAGGGTGGGAGAGAGAATTGGCTTAAGTTGCCTATTTGCACTCCTCTTCATTGCACTTCTTAGGACTGCCTATGAAAGTCAGTTTTGCACTTTAAGTCTGTATCTTCTCCTCTGTGTTCTTTTCTGGACTCGTATTTTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

112

Amino Acids

12.94

Weight (kDa)

7.66

Isoelectric Point (pI)

21.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022589)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0326971 RchiOBHm_Chr4g0400641 RchiOBHm_Chr5g0035441
rosa_samantha Rh2AG312900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 74
AcsI RAATTY 1 cut(s) 139
AflII CTTAAG 1 cut(s) 220
AgsI TTSAA 1 cut(s) 126
ApoI RAATTY 1 cut(s) 139
ArsI GACNNNNNNTTYG 1 cut(s) 316
BccI CCATC 1 cut(s) 151
BcgI CGANNNNNNTGC 2 cut(s) 153, 187
BfaI CTAG 1 cut(s) 183
BfrI CTTAAG 1 cut(s) 220
BfuAI ACCTGC 1 cut(s) 74
BpuEI CTTGAG 1 cut(s) 63
Bse3DI GCAATG 1 cut(s) 246
BseMI GCAATG 1 cut(s) 246
BseRI GAGGAG 3 cut(s) 160, 230, 296
BseYI CCCAGC 1 cut(s) 37
BsmI GAATGC 1 cut(s) 164
BspMI ACCTGC 1 cut(s) 74
BspTI CTTAAG 1 cut(s) 220
BsrDI GCAATG 1 cut(s) 246
Bst6I CTCTTC 1 cut(s) 248
BstAFI CTTAAG 1 cut(s) 220
BstDEI CTNAG 1 cut(s) 257
BstMWI GCNNNNNNNGC 1 cut(s) 225
BveI ACCTGC 1 cut(s) 74
CviJI RGCY 1 cut(s) 219
CviKI_1 RGCY 1 cut(s) 219
DdeI CTNAG 1 cut(s) 257
Eam1104I CTCTTC 1 cut(s) 248
EarI CTCTTC 1 cut(s) 248
FaiI YATR 5 cut(s) 30, 52, 116, 191, 270
FspBI CTAG 1 cut(s) 183
GsaI CCCAGC 1 cut(s) 41
HinfI GANTC 1 cut(s) 325
Hpy188III TCNNGA 3 cut(s) 72, 144, 322
HpyCH4V TGCA 4 cut(s) 151, 236, 251, 285
HpyF10VI GCNNNNNNNGC 1 cut(s) 225
HpyF3I CTNAG 1 cut(s) 257
LpnPI CCDG 6 cut(s) 7, 23, 57, 69, 129, 307
MaeI CTAG 1 cut(s) 183
MboII GAAGA 2 cut(s) 235, 293
MluCI AATT 2 cut(s) 139, 213
MlyI GAGTC 1 cut(s) 319
MnlI CCTC 4 cut(s) 181, 192, 251, 317
MseI TTAA 3 cut(s) 132, 221, 290
MspCI CTTAAG 1 cut(s) 220
Mva1269I GAATGC 1 cut(s) 164
MwoI GCNNNNNNNGC 1 cut(s) 225
PctI GAATGC 1 cut(s) 164
PleI GAGTC 1 cut(s) 319
PpsI GAGTC 1 cut(s) 319
PspFI CCCAGC 1 cut(s) 37
SaqAI TTAA 3 cut(s) 132, 221, 290
SchI GAGTC 1 cut(s) 319
SetI ASST 2 cut(s) 88, 101
SgeI CNNG 9 cut(s) 34, 50, 84, 92, 96, 156, 184, 195, 334
SmlI CTYRAG 2 cut(s) 78, 220
SmoI CTYRAG 2 cut(s) 78, 220
Sse9I AATT 2 cut(s) 139, 213
SspMI CTAG 1 cut(s) 183
TasI AATT 2 cut(s) 139, 213
Tru1I TTAA 3 cut(s) 132, 221, 290
Tru9I TTAA 3 cut(s) 132, 221, 290
TspDTI ATGAA 2 cut(s) 235, 285
Vha464I CTTAAG 1 cut(s) 220
XapI RAATTY 1 cut(s) 139
XspI CTAG 1 cut(s) 183
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.