Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0030296

Physical Location & Seq

Genomic Coordinates Reverse (-)

52783698 .. 52785036

Gene Structure 1339 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 135 bp

ATGTTTGATAATTATTTGTTTATGTACAGGGCTTCCGCAGTTTTTGTTGGAGTTTATGAACCTACAAAGCAGAAATTGTTAGAGATGTTTCCTGAAAATCTAAGCGCTTTAGCTCATTTTTTTGAAGGTCTTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000095 GO:0003674 GO:0005215 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005739 GO:0005740 GO:0005743 GO:0006810 GO:0006839 GO:0006855 GO:0006996 GO:0008150 GO:0009507 GO:0009526 GO:0009536 GO:0009657 GO:0009658 GO:0009941 GO:0009987 GO:0015238 GO:0015805 GO:0015893 GO:0016020 GO:0016021 GO:0016043 GO:0019866 GO:0022857 GO:0031090 GO:0031224 GO:0031966 GO:0031967 GO:0031969 GO:0031975 GO:0042170 GO:0042221 GO:0042493 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044425 GO:0044429 GO:0044434 GO:0044435 GO:0044444 GO:0044446 GO:0044464 GO:0050896 GO:0051179 GO:0051181 GO:0051182 GO:0051184 GO:0051185 GO:0051234 GO:0055085 GO:0071702 GO:0071840 GO:0072348 GO:1901682 GO:1901962

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Mito_carr

Protein Analysis

44

Amino Acids

5.17

Weight (kDa)

4.96

Isoelectric Point (pI)

20.62

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0030296)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr5g0051521
rosa_samantha	Rh2BG279600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	36
AfaI	GTAC	1 cut(s)	26
AfeI	AGCGCT	1 cut(s)	106
AgsI	TTSAA	1 cut(s)	125
AluBI	AGCT	1 cut(s)	113
AluI	AGCT	1 cut(s)	113
Aor51HI	AGCGCT	1 cut(s)	106
AspLEI	GCGC	1 cut(s)	107
BfoI	RGCGCY	1 cut(s)	108
Bsp1407I	TGTACA	1 cut(s)	24
BspACI	CCGC	1 cut(s)	36
BsrGI	TGTACA	1 cut(s)	24
BstAUI	TGTACA	1 cut(s)	24
BstDEI	CTNAG	1 cut(s)	101
BstH2I	RGCGCY	1 cut(s)	108
BstHHI	GCGC	1 cut(s)	107
CfoI	GCGC	1 cut(s)	107
Csp6I	GTAC	1 cut(s)	25
CviJI	RGCY	2 cut(s)	32, 113
CviKI_1	RGCY	2 cut(s)	32, 113
CviQI	GTAC	1 cut(s)	25
DdeI	CTNAG	1 cut(s)	101
Eco47III	AGCGCT	1 cut(s)	106
FaiI	YATR	2 cut(s)	23, 57
FspEI	CC	7 cut(s)	13, 14, 33, 49, 75, 105, 111
GlaI	GCGC	1 cut(s)	106
HaeII	RGCGCY	1 cut(s)	108
HhaI	GCGC	1 cut(s)	107
Hin6I	GCGC	1 cut(s)	105
HinP1I	GCGC	1 cut(s)	105
Hpy188III	TCNNGA	1 cut(s)	92
HpyAV	CCTTC	1 cut(s)	119
HpyF3I	CTNAG	1 cut(s)	101
HspAI	GCGC	1 cut(s)	105
LpnPI	CCDG	2 cut(s)	13, 105
MluCI	AATT	2 cut(s)	10, 74
MmeI	TCCRAC	1 cut(s)	28
RsaI	GTAC	1 cut(s)	26
RsaNI	GTAC	1 cut(s)	25
SetI	ASST	3 cut(s)	64, 115, 130
SgeI	CNNG	2 cut(s)	40, 104
Sse9I	AATT	2 cut(s)	10, 74
SsiI	CCGC	1 cut(s)	36
TasI	AATT	2 cut(s)	10, 74
TatI	WGTACW	1 cut(s)	24
TspDTI	ATGAA	1 cut(s)	72

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.