RchiOBHm_Chr5g0072711

Destroys radicals which are normally produced within the cells and which are toxic to biological systems

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
78770434 .. 78772097
1664 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 342 bp
ATGCATGATGTAGATTATAACAATTTCTTCTATATATATATTGATCAGTTACTCTTAATTTGGTCATTTTTGATTCTGCTTCAAGCATATATAATGCATTTAATCATTCTTTTATGGCTTGCGCTAGACAAAGATCAGAAGAAGCTTTCCATTGAATGCACAGCTAATCAGGATCCACTGATAATTAAAGGAGCGAATTATGTTCCTCTGCTCGGGATAGATGTGTGGGAGCATGCTTACTACTTGCAGTACAAAAACGTCAGGCCAGACTATCTGAAGTATATATGGGAGGTTATTAACTGGAAATATGCAAGTGAAGTGTATGAGAAAGAGTATCCTTGA

Protein Analysis

113

Amino Acids

13.77

Weight (kDa)

4.97

Isoelectric Point (pI)

44.22

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Sod_Fe_C PF02777 38 - 106 8.1e-24 Iron/manganese superoxide dismutases, C-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0030210)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0072711
rosa_samantha Rh5AG476400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 18
AclWI GGATC 2 cut(s) 167, 180
AcuI CTGAAG 1 cut(s) 296
AfaI GTAC 1 cut(s) 251
AfiI CCNNNNNNNGG 1 cut(s) 212
AgsI TTSAA 2 cut(s) 83, 155
AluBI AGCT 2 cut(s) 145, 164
AluI AGCT 2 cut(s) 145, 164
AlwI GGATC 2 cut(s) 167, 180
Ama87I CYCGRG 1 cut(s) 212
AoxI GGCC 1 cut(s) 263
AspLEI GCGC 1 cut(s) 124
AvaI CYCGRG 1 cut(s) 212
BamHI GGATCC 1 cut(s) 172
BclI TGATCA 1 cut(s) 43
BfaI CTAG 1 cut(s) 125
BmeT110I CYCGRG 1 cut(s) 212
BmiI GGNNCC 1 cut(s) 174
Bsc4I CCNNNNNNNGG 1 cut(s) 212
Bse1I ACTGG 1 cut(s) 305
BseLI CCNNNNNNNGG 1 cut(s) 212
BseNI ACTGG 1 cut(s) 305
BshFI GGCC 1 cut(s) 265
BsiHKCI CYCGRG 1 cut(s) 212
BslI CCNNNNNNNGG 1 cut(s) 212
BsmI GAATGC 1 cut(s) 161
BsnI GGCC 1 cut(s) 265
BsoBI CYCGRG 1 cut(s) 212
Bsp143I GATC 3 cut(s) 43, 133, 172
BspANI GGCC 1 cut(s) 265
BspLI GGNNCC 1 cut(s) 174
BspPI GGATC 2 cut(s) 167, 180
BsrI ACTGG 1 cut(s) 305
BssMI GATC 3 cut(s) 43, 133, 172
BstC8I GCNNGC 2 cut(s) 120, 234
BstHHI GCGC 1 cut(s) 124
BstKTI GATC 3 cut(s) 46, 136, 175
BstMBI GATC 3 cut(s) 43, 133, 172
BstNSI RCATGY 1 cut(s) 236
BstX2I RGATCY 1 cut(s) 172
BstYI RGATCY 1 cut(s) 172
BsuRI GGCC 1 cut(s) 265
BtsIMutI CAGTG 1 cut(s) 176
Cac8I GCNNGC 2 cut(s) 120, 234
CfoI GCGC 1 cut(s) 124
Csp6I GTAC 1 cut(s) 250
CviAII CATG 2 cut(s) 5, 233
CviJI RGCY 4 cut(s) 118, 145, 164, 265
CviKI_1 RGCY 4 cut(s) 118, 145, 164, 265
CviQI GTAC 1 cut(s) 250
DpnI GATC 3 cut(s) 45, 135, 174
DpnII GATC 3 cut(s) 43, 133, 172
Eco57I CTGAAG 1 cut(s) 296
Eco88I CYCGRG 1 cut(s) 212
EcoT22I ATGCAT 2 cut(s) 6, 99
FaeI CATG 2 cut(s) 8, 236
FatI CATG 2 cut(s) 4, 232
FbaI TGATCA 1 cut(s) 43
FspBI CTAG 1 cut(s) 125
GlaI GCGC 1 cut(s) 123
HaeIII GGCC 1 cut(s) 265
HhaI GCGC 1 cut(s) 124
Hin1II CATG 2 cut(s) 8, 236
Hin6I GCGC 1 cut(s) 122
HinP1I GCGC 1 cut(s) 122
HindIII AAGCTT 1 cut(s) 143
HinfI GANTC 1 cut(s) 73
Hpy188I TCNGA 2 cut(s) 138, 276
Hpy188III TCNNGA 2 cut(s) 170, 214
HpyCH4IV ACGT 1 cut(s) 258
HpyCH4V TGCA 5 cut(s) 4, 97, 159, 247, 311
HpySE526I ACGT 1 cut(s) 258
Hsp92II CATG 2 cut(s) 8, 236
HspAI GCGC 1 cut(s) 122
Ksp22I TGATCA 1 cut(s) 43
Kzo9I GATC 3 cut(s) 43, 133, 172
LmnI GCTCC 2 cut(s) 191, 229
LpnPI CCDG 4 cut(s) 155, 247, 279, 286
MaeI CTAG 1 cut(s) 125
MaeII ACGT 1 cut(s) 258
MaeIII GTNAC 1 cut(s) 48
MalI GATC 3 cut(s) 45, 135, 174
MboI GATC 3 cut(s) 43, 133, 172
MboII GAAGA 2 cut(s) 19, 151
MflI RGATCY 1 cut(s) 172
MluCI AATT 4 cut(s) 22, 57, 183, 196
MnlI CCTC 2 cut(s) 216, 283
Mph1103I ATGCAT 2 cut(s) 6, 99
MseI TTAA 4 cut(s) 56, 101, 186, 297
Mva1269I GAATGC 1 cut(s) 161
NdeII GATC 3 cut(s) 43, 133, 172
NlaIII CATG 2 cut(s) 8, 236
NlaIV GGNNCC 1 cut(s) 174
NsiI ATGCAT 2 cut(s) 6, 99
NspI RCATGY 1 cut(s) 236
PaeI GCATGC 1 cut(s) 236
PctI GAATGC 1 cut(s) 161
PfeI GAWTC 1 cut(s) 73
PsiI TTATAA 1 cut(s) 18
PspN4I GGNNCC 1 cut(s) 174
PsuI RGATCY 1 cut(s) 172
RsaI GTAC 1 cut(s) 251
RsaNI GTAC 1 cut(s) 250
SaqAI TTAA 4 cut(s) 56, 101, 186, 297
Sau3AI GATC 3 cut(s) 43, 133, 172
SetI ASST 4 cut(s) 147, 166, 261, 294
SphI GCATGC 1 cut(s) 236
Sse9I AATT 4 cut(s) 22, 57, 183, 196
SspMI CTAG 1 cut(s) 125
TaiI ACGT 1 cut(s) 261
TasI AATT 4 cut(s) 22, 57, 183, 196
TatI WGTACW 1 cut(s) 249
TfiI GAWTC 1 cut(s) 73
Tru1I TTAA 4 cut(s) 56, 101, 186, 297
Tru9I TTAA 4 cut(s) 56, 101, 186, 297
TscAI CASTG 1 cut(s) 183
TspRI CASTG 1 cut(s) 183
XceI RCATGY 1 cut(s) 236
XspI CTAG 1 cut(s) 125
Zsp2I ATGCAT 2 cut(s) 6, 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.