RchiOBHm_Chr5g0075391

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
81211185 .. 81215852
4668 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 132 bp
ATGCAGAGTGTTGAAGAAATTAAAAGAAGTCATCCTGAAGAAATTGAAAACTGCAATAGCATTCGAGATTGCAAGAATTATATGGAACAATGGTTGTCTTCTCTTCAAAACTTTGATGCCTCAATTAGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

43

Amino Acids

5.09

Weight (kDa)

4.59

Isoelectric Point (pI)

100.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0025028)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0075391
rosa_roxburghii Rroxscaffold_1G00008210
rosa_samantha Rh1BG144500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 57
AgsI TTSAA 3 cut(s) 14, 47, 107
AluBI AGCT 1 cut(s) 129
AluI AGCT 1 cut(s) 129
BbsI GAAGAC 1 cut(s) 90
BmsI GCATC 1 cut(s) 106
BpiI GAAGAC 1 cut(s) 90
BseGI GGATG 1 cut(s) 31
BsmI GAATGC 1 cut(s) 60
Bst6I CTCTTC 1 cut(s) 108
BstF5I GGATG 1 cut(s) 31
BstV2I GAAGAC 1 cut(s) 90
BtsCI GGATG 1 cut(s) 31
CviJI RGCY 1 cut(s) 129
CviKI_1 RGCY 1 cut(s) 129
Eam1104I CTCTTC 1 cut(s) 108
EarI CTCTTC 1 cut(s) 108
Eco57I CTGAAG 1 cut(s) 57
FaiI YATR 2 cut(s) 81, 83
FokI GGATG 1 cut(s) 18
FspEI CC 3 cut(s) 48, 68, 76
Hpy188III TCNNGA 2 cut(s) 35, 65
HpyCH4V TGCA 3 cut(s) 4, 54, 72
LpnPI CCDG 1 cut(s) 48
LweI GCATC 1 cut(s) 106
MboII GAAGA 4 cut(s) 26, 50, 90, 95
MluCI AATT 4 cut(s) 18, 42, 76, 123
MnlI CCTC 1 cut(s) 130
MseI TTAA 1 cut(s) 21
Mva1269I GAATGC 1 cut(s) 60
PctI GAATGC 1 cut(s) 60
SaqAI TTAA 1 cut(s) 21
SetI ASST 1 cut(s) 131
SfaNI GCATC 1 cut(s) 106
SgeI CNNG 3 cut(s) 47, 77, 85
Sse9I AATT 4 cut(s) 18, 42, 76, 123
TaqI TCGA 1 cut(s) 64
TasI AATT 4 cut(s) 18, 42, 76, 123
Tru1I TTAA 1 cut(s) 21
Tru9I TTAA 1 cut(s) 21
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.