Rroxscaffold_1G00008210

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
10334616 .. 10338881
4266 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00008210.1

Sequence Viewer

Length: 162 bp
ATGCTACTCTGGCATAGTCTGCATATTATTGTAATGTCTACTCTAACAATTCGACATGTACGTATATACAATCCTTTTGTAATTCTTTTTATGATGTCTAGGAGTGTTGAAGAAATTAAAAGAAGTCATCCTGAAGAAATTGAAAACTGCAATAGCATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

53

Amino Acids

6.37

Weight (kDa)

6.9

Isoelectric Point (pI)

106.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0025028)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0075391
rosa_roxburghii Rroxscaffold_1G00008210
rosa_samantha Rh1BG144500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 38
AcuI CTGAAG 1 cut(s) 153
AfaI GTAC 1 cut(s) 60
AflIII ACRYGT 1 cut(s) 55
AgsI TTSAA 2 cut(s) 110, 143
BfaI CTAG 1 cut(s) 99
BsaAI YACGTR 1 cut(s) 62
BseGI GGATG 1 cut(s) 127
BstAPI GCANNNNNTGC 1 cut(s) 19
BstBAI YACGTR 1 cut(s) 62
BstF5I GGATG 1 cut(s) 127
BstMWI GCNNNNNNNGC 2 cut(s) 10, 19
BstNSI RCATGY 1 cut(s) 59
BstSNI TACGTA 1 cut(s) 62
BtsCI GGATG 1 cut(s) 127
Csp6I GTAC 1 cut(s) 59
CviAII CATG 1 cut(s) 56
CviQI GTAC 1 cut(s) 59
Eco105I TACGTA 1 cut(s) 62
Eco57I CTGAAG 1 cut(s) 153
FaeI CATG 1 cut(s) 59
FaiI YATR 6 cut(s) 15, 24, 57, 65, 67, 92
FatI CATG 1 cut(s) 55
FblI GTMKAC 1 cut(s) 38
FokI GGATG 1 cut(s) 114
FspBI CTAG 1 cut(s) 99
FspEI CC 3 cut(s) 85, 87, 144
Hin1II CATG 1 cut(s) 59
Hpy166II GTNNAC 1 cut(s) 39
Hpy188III TCNNGA 1 cut(s) 131
Hpy8I GTNNAC 1 cut(s) 39
HpyCH4IV ACGT 1 cut(s) 61
HpyCH4V TGCA 2 cut(s) 22, 150
HpyF10VI GCNNNNNNNGC 2 cut(s) 10, 19
HpySE526I ACGT 1 cut(s) 61
Hsp92II CATG 1 cut(s) 59
LpnPI CCDG 1 cut(s) 144
MaeI CTAG 1 cut(s) 99
MaeII ACGT 1 cut(s) 61
MboII GAAGA 2 cut(s) 122, 146
MluCI AATT 4 cut(s) 48, 81, 114, 138
MseI TTAA 1 cut(s) 117
MwoI GCNNNNNNNGC 2 cut(s) 10, 19
NlaIII CATG 1 cut(s) 59
NspI RCATGY 1 cut(s) 59
PciI ACATGT 1 cut(s) 55
PcsI WCGNNNNNNNCGW 1 cut(s) 58
Ppu21I YACGTR 1 cut(s) 62
PscI ACATGT 1 cut(s) 55
RsaI GTAC 1 cut(s) 60
RsaNI GTAC 1 cut(s) 59
SaqAI TTAA 1 cut(s) 117
SetI ASST 1 cut(s) 64
SgeI CNNG 4 cut(s) 22, 68, 111, 143
SnaBI TACGTA 1 cut(s) 62
Sse9I AATT 4 cut(s) 48, 81, 114, 138
SspMI CTAG 1 cut(s) 99
TaiI ACGT 1 cut(s) 64
TaqI TCGA 1 cut(s) 52
TasI AATT 4 cut(s) 48, 81, 114, 138
Tru1I TTAA 1 cut(s) 117
Tru9I TTAA 1 cut(s) 117
XceI RCATGY 1 cut(s) 59
XmiI GTMKAC 1 cut(s) 38
XspI CTAG 1 cut(s) 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.