Rh1BG144500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
Physical Location & Seq
Reverse (-)
23861716 .. 23863202
1487 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG144500.1

Sequence Viewer

Length: 165 bp
ATGCAGAGTGTTGAAGAAATTAAAAGAAGTCATCCTGAAGAAATTGAAAACTACAATAGCATTCGAGGTACTATCTTAATCTCTAGAATTCTTTTGGAACCTCCTATATATGTCTATGACTTACAAAGAAAAGTTTTCTCCAAATGGGATGTAGTATCAGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

54

Amino Acids

6.44

Weight (kDa)

5.25

Isoelectric Point (pI)

81.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0025028)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0075391
rosa_roxburghii Rroxscaffold_1G00008210
rosa_samantha Rh1BG144500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 87
AcuI CTGAAG 1 cut(s) 57
AfaI GTAC 1 cut(s) 70
AgsI TTSAA 2 cut(s) 14, 47
ApoI RAATTY 1 cut(s) 87
BfaI CTAG 1 cut(s) 84
BmiI GGNNCC 1 cut(s) 99
BseGI GGATG 2 cut(s) 31, 154
BsmI GAATGC 1 cut(s) 60
BspLI GGNNCC 1 cut(s) 99
BstF5I GGATG 2 cut(s) 31, 154
BtsCI GGATG 2 cut(s) 31, 154
Csp6I GTAC 1 cut(s) 69
CviQI GTAC 1 cut(s) 69
Eco57I CTGAAG 1 cut(s) 57
EcoRI GAATTC 1 cut(s) 87
FaiI YATR 4 cut(s) 107, 109, 111, 117
FokI GGATG 2 cut(s) 18, 161
FspBI CTAG 1 cut(s) 84
FspEI CC 8 cut(s) 48, 51, 80, 114, 117, 130, 131, 154
Hpy188I TCNGA 1 cut(s) 160
Hpy188III TCNNGA 2 cut(s) 35, 84
HpyCH4V TGCA 1 cut(s) 4
LpnPI CCDG 1 cut(s) 48
MaeI CTAG 1 cut(s) 84
MboII GAAGA 2 cut(s) 26, 50
MluCI AATT 3 cut(s) 18, 42, 87
MnlI CCTC 2 cut(s) 59, 111
MseI TTAA 3 cut(s) 21, 77, 163
Mva1269I GAATGC 1 cut(s) 60
NlaIV GGNNCC 1 cut(s) 99
PctI GAATGC 1 cut(s) 60
PspN4I GGNNCC 1 cut(s) 99
RsaI GTAC 1 cut(s) 70
RsaNI GTAC 1 cut(s) 69
SaqAI TTAA 3 cut(s) 21, 77, 163
SetI ASST 2 cut(s) 70, 103
SgeI CNNG 3 cut(s) 47, 77, 96
Sse9I AATT 3 cut(s) 18, 42, 87
SspMI CTAG 1 cut(s) 84
TaqI TCGA 1 cut(s) 64
TasI AATT 3 cut(s) 18, 42, 87
Tru1I TTAA 3 cut(s) 21, 77, 163
Tru9I TTAA 3 cut(s) 21, 77, 163
XapI RAATTY 1 cut(s) 87
XbaI TCTAGA 1 cut(s) 83
XspI CTAG 1 cut(s) 84
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.