RchiOBHm_Chr4g0386191

Eukaryotic initiation factor

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
1743682 .. 1744002
321 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 216 bp
ATGTTGAGCATAAGCTTCAAGAAGAAAATTTACGAAGTCTACAGACATCTACAAGATACCCTACAAGTTTGCTTGATCTCCGCGACGCTCCCTAATGAAATTTTGGAGATGACCAACAAGTTCATGACCGATCCTATAAGGATCCTGGTTAAACGTGACGAGCTGACTTTGGAGGGAATCAAGCAATTTTTCGTTGCAGTTGAAAAAGAAGATTAG

Protein Analysis

71

Amino Acids

8.38

Weight (kDa)

5.78

Isoelectric Point (pI)

34.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022346)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 39
AccII CGCG 1 cut(s) 83
AciI CCGC 1 cut(s) 81
AclWI GGATC 3 cut(s) 125, 136, 149
AcsI RAATTY 2 cut(s) 27, 99
AgsI TTSAA 2 cut(s) 19, 203
AjnI CCWGG 1 cut(s) 144
AluBI AGCT 2 cut(s) 15, 163
AluI AGCT 2 cut(s) 15, 163
AlwI GGATC 3 cut(s) 125, 136, 149
ApoI RAATTY 2 cut(s) 27, 99
BamHI GGATCC 1 cut(s) 141
BarI GAAGNNNNNNTAC 2 cut(s) 14, 46
BciT130I CCWGG 1 cut(s) 146
BfmI CTRYAG 1 cut(s) 40
Bme1390I CCNGG 1 cut(s) 146
BmiI GGNNCC 1 cut(s) 143
BmrFI CCNGG 1 cut(s) 146
BseBI CCWGG 1 cut(s) 146
Bsh1236I CGCG 1 cut(s) 83
Bsp143I GATC 3 cut(s) 75, 130, 141
BspACI CCGC 1 cut(s) 81
BspFNI CGCG 1 cut(s) 83
BspHI TCATGA 1 cut(s) 123
BspLI GGNNCC 1 cut(s) 143
BspPI GGATC 3 cut(s) 125, 136, 149
BssMI GATC 3 cut(s) 75, 130, 141
Bst2UI CCWGG 1 cut(s) 146
BstFNI CGCG 1 cut(s) 83
BstKTI GATC 3 cut(s) 78, 133, 144
BstMBI GATC 3 cut(s) 75, 130, 141
BstNI CCWGG 1 cut(s) 146
BstSCI CCNGG 1 cut(s) 144
BstSFI CTRYAG 1 cut(s) 40
BstUI CGCG 1 cut(s) 83
BstX2I RGATCY 1 cut(s) 141
BstYI RGATCY 1 cut(s) 141
CciI TCATGA 1 cut(s) 123
CseI GACGC 1 cut(s) 94
CviAII CATG 1 cut(s) 124
CviJI RGCY 2 cut(s) 15, 163
CviKI_1 RGCY 2 cut(s) 15, 163
DpnI GATC 3 cut(s) 77, 132, 143
DpnII GATC 3 cut(s) 75, 130, 141
EcoRII CCWGG 1 cut(s) 144
FaeI CATG 1 cut(s) 127
FaiI YATR 3 cut(s) 11, 125, 137
FatI CATG 1 cut(s) 123
FblI GTMKAC 1 cut(s) 39
HgaI GACGC 1 cut(s) 94
Hin1II CATG 1 cut(s) 127
HindIII AAGCTT 1 cut(s) 13
HinfI GANTC 1 cut(s) 177
Hpy166II GTNNAC 1 cut(s) 40
Hpy188III TCNNGA 2 cut(s) 19, 124
Hpy8I GTNNAC 1 cut(s) 40
Hpy99I CGWCG 1 cut(s) 88
HpyCH4IV ACGT 1 cut(s) 154
HpyCH4V TGCA 1 cut(s) 197
HpySE526I ACGT 1 cut(s) 154
Hsp92II CATG 1 cut(s) 127
Kzo9I GATC 3 cut(s) 75, 130, 141
LmnI GCTCC 1 cut(s) 93
LpnPI CCDG 2 cut(s) 131, 158
MaeII ACGT 1 cut(s) 154
MaeIII GTNAC 1 cut(s) 155
MalI GATC 3 cut(s) 77, 132, 143
MboI GATC 3 cut(s) 75, 130, 141
MboII GAAGA 1 cut(s) 34
MflI RGATCY 1 cut(s) 141
MluCI AATT 3 cut(s) 27, 99, 185
MnlI CCTC 1 cut(s) 166
MseI TTAA 1 cut(s) 150
MspR9I CCNGG 1 cut(s) 146
MvaI CCWGG 1 cut(s) 146
MvnI CGCG 1 cut(s) 83
NdeII GATC 3 cut(s) 75, 130, 141
NlaIII CATG 1 cut(s) 127
NlaIV GGNNCC 1 cut(s) 143
NmuCI GTSAC 1 cut(s) 155
PagI TCATGA 1 cut(s) 123
PfeI GAWTC 1 cut(s) 177
Psp6I CCWGG 1 cut(s) 144
PspGI CCWGG 1 cut(s) 144
PspN4I GGNNCC 1 cut(s) 143
PsuI RGATCY 1 cut(s) 141
SaqAI TTAA 1 cut(s) 150
Sau3AI GATC 3 cut(s) 75, 130, 141
ScrFI CCNGG 1 cut(s) 146
SetI ASST 3 cut(s) 17, 157, 165
SfcI CTRYAG 1 cut(s) 40
Sse9I AATT 3 cut(s) 27, 99, 185
SsiI CCGC 1 cut(s) 81
StyD4I CCNGG 1 cut(s) 144
TaiI ACGT 1 cut(s) 157
TaqII GACCGA 1 cut(s) 143
TasI AATT 3 cut(s) 27, 99, 185
TfiI GAWTC 1 cut(s) 177
Tru1I TTAA 1 cut(s) 150
Tru9I TTAA 1 cut(s) 150
TseFI GTSAC 1 cut(s) 155
Tsp45I GTSAC 1 cut(s) 155
TspDTI ATGAA 2 cut(s) 111, 112
XapI RAATTY 2 cut(s) 27, 99
XmiI GTMKAC 1 cut(s) 39
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.