RchiOBHm_Chr4g0413871
ERF Family

Belongs to the small GTPase superfamily. Arf family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
38244449 .. 38245801
1353 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 195 bp
ATGTCGGGGGTCAGGACAATGTATGAAAACACACAGGGTCTTACCTTTGTTGTAGACAGCAATGACAGAGACCGTGTTGTTGAGGCAAGGGATGGATTGCACAGGATGTCAAATGAGAACACTCGTGCAACCTCTGGAGAGGGTCTATATGAAGGCCTGGATTGGCTCTCCAACAACATTGCTAACAAGGCTTGA

Protein Analysis

64

Amino Acids

7.16

Weight (kDa)

4.87

Isoelectric Point (pI)

32.64

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Arf PF00025 5 - 41 1.7e-06 ADP-ribosylation factor family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024982)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0413871
rosa_samantha Rh4AG182900 Rh4CG194600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 54
AjnI CCWGG 1 cut(s) 156
Alw26I GTCTC 1 cut(s) 63
AoxI GGCC 1 cut(s) 154
BauI CACGAG 1 cut(s) 123
BccI CCATC 1 cut(s) 86
BciT130I CCWGG 1 cut(s) 158
BcoDI GTCTC 1 cut(s) 63
Bme1390I CCNGG 1 cut(s) 158
BmrFI CCNGG 1 cut(s) 158
BpmI CTGGAG 1 cut(s) 156
BsaI GGTCTC 1 cut(s) 63
Bse3DI GCAATG 2 cut(s) 67, 177
BseBI CCWGG 1 cut(s) 158
BseGI GGATG 2 cut(s) 97, 111
BseMI GCAATG 2 cut(s) 67, 177
BshFI GGCC 1 cut(s) 156
BsmAI GTCTC 1 cut(s) 63
BsnI GGCC 1 cut(s) 156
Bso31I GGTCTC 1 cut(s) 63
BspANI GGCC 1 cut(s) 156
BspTNI GGTCTC 1 cut(s) 63
BsrDI GCAATG 2 cut(s) 67, 177
BssSI CACGAG 1 cut(s) 123
Bst2BI CACGAG 1 cut(s) 123
Bst2UI CCWGG 1 cut(s) 158
Bst4CI ACNGT 1 cut(s) 74
BstF5I GGATG 2 cut(s) 97, 111
BstMAI GTCTC 1 cut(s) 63
BstMWI GCNNNNNNNGC 1 cut(s) 188
BstNI CCWGG 1 cut(s) 158
BstSCI CCNGG 1 cut(s) 156
BsuRI GGCC 1 cut(s) 156
BtsCI GGATG 2 cut(s) 97, 111
CviJI RGCY 3 cut(s) 156, 166, 191
CviKI_1 RGCY 3 cut(s) 156, 166, 191
Eco147I AGGCCT 1 cut(s) 156
Eco31I GGTCTC 1 cut(s) 63
EcoRII CCWGG 1 cut(s) 156
FaiI YATR 3 cut(s) 24, 148, 150
FblI GTMKAC 1 cut(s) 54
FokI GGATG 2 cut(s) 104, 118
GsuI CTGGAG 1 cut(s) 156
HaeIII GGCC 1 cut(s) 156
Hpy166II GTNNAC 1 cut(s) 55
Hpy188III TCNNGA 2 cut(s) 13, 135
Hpy8I GTNNAC 1 cut(s) 55
HpyAV CCTTC 1 cut(s) 146
HpyCH4III ACNGT 1 cut(s) 74
HpyCH4V TGCA 2 cut(s) 100, 128
HpyF10VI GCNNNNNNNGC 1 cut(s) 188
LpnPI CCDG 5 cut(s) 20, 88, 120, 143, 170
MmeI TCCRAC 1 cut(s) 195
MnlI CCTC 3 cut(s) 76, 133, 142
MspR9I CCNGG 1 cut(s) 158
MvaI CCWGG 1 cut(s) 158
MwoI GCNNNNNNNGC 1 cut(s) 188
PceI AGGCCT 1 cut(s) 156
Psp6I CCWGG 1 cut(s) 156
PspGI CCWGG 1 cut(s) 156
ScrFI CCNGG 1 cut(s) 158
SetI ASST 2 cut(s) 47, 134
SseBI AGGCCT 1 cut(s) 156
StuI AGGCCT 1 cut(s) 156
StyD4I CCNGG 1 cut(s) 156
TaaI ACNGT 1 cut(s) 74
TspDTI ATGAA 2 cut(s) 39, 165
XmiI GTMKAC 1 cut(s) 54
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.