Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr4A

Orthogroup ID

OG0024982

Physical Location & Seq

Genomic Coordinates Reverse (-)

45471316 .. 45480014

Gene Structure 8699 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh4AG182900.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 153 bp

ATGGAGCTTGATAGAGGTCTGACCTTTTTGGGGGCACTACTTCCGATCCAGAACACACAGGGTCTTATCTTTGTTGTAGACAGCAATGACAGAGACCGTGTTGTTGAGGCAAGGGATGGATTGCACAGGATGTCAAATGAGGATGAGCTGTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005794 GO:0012505 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464

KEGG Pathways

Metabolic & Signaling

ko04072 ko04144 ko05110 ko05134 map04072 map04144 map05110 map05134

Pfam Domains

Protein Families

Arf

Protein Analysis

50

Amino Acids

5.67

Weight (kDa)

4.41

Isoelectric Point (pI)

18.48

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Arf	PF00025	17 - 50	2.9e-07	ADP-ribosylation factor family

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0024982)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr4g0413871
rosa_samantha	Rh4AG182900 Rh4CG194600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	78
AclWI	GGATC	1 cut(s)	40
AfiI	CCNNNNNNNGG	1 cut(s)	30
AluBI	AGCT	2 cut(s)	7, 148
AluI	AGCT	2 cut(s)	7, 148
Alw26I	GTCTC	1 cut(s)	87
AlwI	GGATC	1 cut(s)	40
BaeGI	GKGCMC	1 cut(s)	37
BccI	CCATC	1 cut(s)	110
BcoDI	GTCTC	1 cut(s)	87
BsaI	GGTCTC	1 cut(s)	87
Bsc4I	CCNNNNNNNGG	1 cut(s)	30
Bse3DI	GCAATG	1 cut(s)	91
BseGI	GGATG	3 cut(s)	121, 135, 148
BseLI	CCNNNNNNNGG	1 cut(s)	30
BseMI	GCAATG	1 cut(s)	91
BseSI	GKGCMC	1 cut(s)	37
BslI	CCNNNNNNNGG	1 cut(s)	30
BsmAI	GTCTC	1 cut(s)	87
Bso31I	GGTCTC	1 cut(s)	87
Bsp1286I	GDGCHC	1 cut(s)	37
Bsp143I	GATC	1 cut(s)	45
BspPI	GGATC	1 cut(s)	40
BspTNI	GGTCTC	1 cut(s)	87
BsrDI	GCAATG	1 cut(s)	91
BssMI	GATC	1 cut(s)	45
Bst4CI	ACNGT	1 cut(s)	98
BstF5I	GGATG	3 cut(s)	121, 135, 148
BstKTI	GATC	1 cut(s)	48
BstMAI	GTCTC	1 cut(s)	87
BstMBI	GATC	1 cut(s)	45
BstSLI	GKGCMC	1 cut(s)	37
BtsCI	GGATG	3 cut(s)	121, 135, 148
CviJI	RGCY	2 cut(s)	7, 148
CviKI_1	RGCY	2 cut(s)	7, 148
DpnI	GATC	1 cut(s)	47
DpnII	GATC	1 cut(s)	45
Eco31I	GGTCTC	1 cut(s)	87
FblI	GTMKAC	1 cut(s)	78
FokI	GGATG	2 cut(s)	128, 142
Hpy166II	GTNNAC	1 cut(s)	79
Hpy188I	TCNGA	2 cut(s)	21, 45
Hpy188III	TCNNGA	1 cut(s)	49
Hpy8I	GTNNAC	1 cut(s)	79
HpyCH4III	ACNGT	1 cut(s)	98
HpyCH4V	TGCA	1 cut(s)	124
Kzo9I	GATC	1 cut(s)	45
LmnI	GCTCC	1 cut(s)	4
LpnPI	CCDG	3 cut(s)	44, 62, 112
MalI	GATC	1 cut(s)	47
MboI	GATC	1 cut(s)	45
MhlI	GDGCHC	1 cut(s)	37
MnlI	CCTC	3 cut(s)	8, 100, 133
NdeII	GATC	1 cut(s)	45
Sau3AI	GATC	1 cut(s)	45
SduI	GDGCHC	1 cut(s)	37
SetI	ASST	4 cut(s)	9, 19, 26, 150
SgeI	CNNG	6 cut(s)	20, 61, 71, 110, 123, 139
TaaI	ACNGT	1 cut(s)	98
XmiI	GTMKAC	1 cut(s)	78

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.