Rh4CG194600
ERF Family

Belongs to the small GTPase superfamily. Arf family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Reverse (-)
41603761 .. 41622285
18525 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG194600.1

Sequence Viewer

Length: 162 bp
ATGAGAAGATTTGCAGATAGTCGGTCAATCGGTGTCTATATAATTGGATCGTGGCAACCCAACACACAGGGTCTTATCTTTGTTGAAGACAGCAATAACAAAGACCGTGTTGTTGAGGCAAGGGATGTATTGCACAGGATGTCAAATGAGGATGAGCTGTGA

Protein Analysis

53

Amino Acids

6.17

Weight (kDa)

5.12

Isoelectric Point (pI)

54.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024982)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0413871
rosa_samantha Rh4AG182900 Rh4CG194600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 55
AgsI TTSAA 1 cut(s) 86
AluBI AGCT 1 cut(s) 157
AluI AGCT 1 cut(s) 157
AlwI GGATC 1 cut(s) 55
BbsI GAAGAC 1 cut(s) 93
BpiI GAAGAC 1 cut(s) 93
BseGI GGATG 3 cut(s) 130, 144, 157
Bsp143I GATC 1 cut(s) 47
BspPI GGATC 1 cut(s) 55
BssMI GATC 1 cut(s) 47
Bst4CI ACNGT 1 cut(s) 107
BstF5I GGATG 3 cut(s) 130, 144, 157
BstKTI GATC 1 cut(s) 50
BstMBI GATC 1 cut(s) 47
BstV2I GAAGAC 1 cut(s) 93
BtsCI GGATG 3 cut(s) 130, 144, 157
CviJI RGCY 1 cut(s) 157
CviKI_1 RGCY 1 cut(s) 157
DpnI GATC 1 cut(s) 49
DpnII GATC 1 cut(s) 47
FaiI YATR 2 cut(s) 39, 41
FokI GGATG 2 cut(s) 137, 151
HpyCH4III ACNGT 1 cut(s) 107
HpyCH4V TGCA 2 cut(s) 14, 133
Kzo9I GATC 1 cut(s) 47
LpnPI CCDG 2 cut(s) 53, 121
MalI GATC 1 cut(s) 49
MboI GATC 1 cut(s) 47
MboII GAAGA 2 cut(s) 18, 98
MluCI AATT 1 cut(s) 42
MnlI CCTC 2 cut(s) 109, 142
NdeII GATC 1 cut(s) 47
Sau3AI GATC 1 cut(s) 47
SetI ASST 1 cut(s) 159
SgeI CNNG 5 cut(s) 63, 80, 119, 132, 148
Sse9I AATT 1 cut(s) 42
TaaI ACNGT 1 cut(s) 107
TaqII GACCGA 1 cut(s) 12
TasI AATT 1 cut(s) 42
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.