RchiOBHm_Chr4g0437171

importin subunit

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
60345664 .. 60345949
286 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 177 bp
ATGGCTGCTGGAGTGCTGAATAATATAGCTGCTGGAACCTTAAAGGACACCAAGGTGGTCATTGATCATTCAGCAATACCAGGATTTGTAAAGCTGCTTGCTTCACCATTTGATTTTGTTAAGGAGGAGCGGCATCTCCTGAATATCATGATCTTCTTCTCAGCAGCCGAGTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

58

Amino Acids

6.26

Weight (kDa)

6.0

Isoelectric Point (pI)

41.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022742)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0437171
rosa_roxburghii Rroxscaffold_5G00378230
rosa_samantha Rh4AG353400 Rh4DG357200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 130
AciI CCGC 1 cut(s) 130
AjnI CCWGG 1 cut(s) 79
AleI CACNNNNGTG 1 cut(s) 53
AluBI AGCT 2 cut(s) 29, 94
AluI AGCT 2 cut(s) 29, 94
ApeKI GCWGC 4 cut(s) 5, 29, 94, 164
AsuHPI GGTGA 1 cut(s) 96
BbvI GCAGC 2 cut(s) 16, 81
BciT130I CCWGG 1 cut(s) 81
BclI TGATCA 1 cut(s) 64
BisI GCNGC 5 cut(s) 6, 30, 95, 131, 165
BlsI GCNGC 5 cut(s) 7, 31, 96, 132, 166
Bme1390I CCNGG 1 cut(s) 81
BmiI GGNNCC 1 cut(s) 37
BmrFI CCNGG 1 cut(s) 81
BmsI GCATC 1 cut(s) 142
BpmI CTGGAG 1 cut(s) 30
BsaJI CCNNGG 1 cut(s) 51
BseBI CCWGG 1 cut(s) 81
BseDI CCNNGG 1 cut(s) 51
BseMII CTCAG 1 cut(s) 174
BseRI GAGGAG 1 cut(s) 140
BseXI GCAGC 2 cut(s) 16, 81
Bsp143I GATC 2 cut(s) 64, 150
BspACI CCGC 1 cut(s) 130
BspCNI CTCAG 1 cut(s) 173
BspHI TCATGA 1 cut(s) 147
BspLI GGNNCC 1 cut(s) 37
BsrBI CCGCTC 1 cut(s) 130
BssECI CCNNGG 1 cut(s) 51
BssMI GATC 2 cut(s) 64, 150
BssT1I CCWWGG 1 cut(s) 51
Bst2UI CCWGG 1 cut(s) 81
BstC8I GCNNGC 1 cut(s) 99
BstDEI CTNAG 1 cut(s) 160
BstKTI GATC 2 cut(s) 67, 153
BstMBI GATC 2 cut(s) 64, 150
BstNI CCWGG 1 cut(s) 81
BstSCI CCNGG 1 cut(s) 79
BstV1I GCAGC 2 cut(s) 16, 81
Cac8I GCNNGC 1 cut(s) 99
CciI TCATGA 1 cut(s) 147
CviAII CATG 1 cut(s) 148
CviJI RGCY 4 cut(s) 5, 29, 94, 167
CviKI_1 RGCY 4 cut(s) 5, 29, 94, 167
DdeI CTNAG 1 cut(s) 160
DpnI GATC 2 cut(s) 66, 152
DpnII GATC 2 cut(s) 64, 150
Eco130I CCWWGG 1 cut(s) 51
EcoRII CCWGG 1 cut(s) 79
EcoT14I CCWWGG 1 cut(s) 51
ErhI CCWWGG 1 cut(s) 51
FaeI CATG 1 cut(s) 151
FaiI YATR 2 cut(s) 26, 149
FatI CATG 1 cut(s) 147
FbaI TGATCA 1 cut(s) 64
Fnu4HI GCNGC 5 cut(s) 6, 30, 95, 131, 165
Fsp4HI GCNGC 5 cut(s) 6, 30, 95, 131, 165
GluI GCNGC 5 cut(s) 6, 30, 95, 131, 165
GsuI CTGGAG 1 cut(s) 30
Hin1II CATG 1 cut(s) 151
HinfI GANTC 1 cut(s) 170
HphI GGTGA 1 cut(s) 96
Hpy188III TCNNGA 3 cut(s) 139, 148, 174
HpyF3I CTNAG 1 cut(s) 160
Hsp92II CATG 1 cut(s) 151
Ksp22I TGATCA 1 cut(s) 64
Kzo9I GATC 2 cut(s) 64, 150
LmnI GCTCC 1 cut(s) 127
LpnPI CCDG 4 cut(s) 18, 66, 93, 152
Lsp1109I GCAGC 2 cut(s) 16, 81
LweI GCATC 1 cut(s) 142
MalI GATC 2 cut(s) 66, 152
MbiI CCGCTC 1 cut(s) 130
MboI GATC 2 cut(s) 64, 150
MboII GAAGA 2 cut(s) 145, 148
MnlI CCTC 1 cut(s) 118
MseI TTAA 2 cut(s) 41, 120
MslI CAYNNNNRTG 1 cut(s) 53
MspR9I CCNGG 1 cut(s) 81
MvaI CCWGG 1 cut(s) 81
NdeII GATC 2 cut(s) 64, 150
NlaIII CATG 1 cut(s) 151
NlaIV GGNNCC 1 cut(s) 37
OliI CACNNNNGTG 1 cut(s) 53
PagI TCATGA 1 cut(s) 147
PkrI GCNGC 5 cut(s) 7, 31, 96, 132, 166
Psp6I CCWGG 1 cut(s) 79
PspGI CCWGG 1 cut(s) 79
PspN4I GGNNCC 1 cut(s) 37
RseI CAYNNNNRTG 1 cut(s) 53
SaqAI TTAA 2 cut(s) 41, 120
SatI GCNGC 5 cut(s) 6, 30, 95, 131, 165
Sau3AI GATC 2 cut(s) 64, 150
ScrFI CCNGG 1 cut(s) 81
SetI ASST 4 cut(s) 31, 41, 57, 96
SfaNI GCATC 1 cut(s) 142
SgeI CNNG 8 cut(s) 21, 45, 64, 92, 93, 110, 151, 160
SmiMI CAYNNNNRTG 1 cut(s) 53
SsiI CCGC 1 cut(s) 130
StyD4I CCNGG 1 cut(s) 79
StyI CCWWGG 1 cut(s) 51
TauI GCSGC 1 cut(s) 133
Tru1I TTAA 2 cut(s) 41, 120
Tru9I TTAA 2 cut(s) 41, 120
TseI GCWGC 4 cut(s) 5, 29, 94, 164
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.