Rh4DG357200

importin subunit

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
Physical Location & Seq
Forward (+)
57800353 .. 57800666
314 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG357200.1

Sequence Viewer

Length: 171 bp
ATGGCTGCTGGAGTGCTGAATAATATAGCTGCTGGAACCTTAAAGGACACCAAGGTGGTCATTGATCATTCAGCAATACCAGGATTTGTAAAGCTGCTTGCTTCACCATTTGATTTTGTTAAGGAGGAGCAGCCGAGTCTTGATGCTACTGCAGGACTAGGTGAACCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

56

Amino Acids

5.77

Weight (kDa)

4.65

Isoelectric Point (pI)

39.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022742)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0437171
rosa_roxburghii Rroxscaffold_5G00378230
rosa_samantha Rh4AG353400 Rh4DG357200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjnI CCWGG 1 cut(s) 79
AleI CACNNNNGTG 1 cut(s) 53
AluBI AGCT 2 cut(s) 29, 94
AluI AGCT 2 cut(s) 29, 94
ApeKI GCWGC 4 cut(s) 5, 29, 94, 130
AsuHPI GGTGA 1 cut(s) 96
BbvI GCAGC 3 cut(s) 16, 81, 142
BciT130I CCWGG 1 cut(s) 81
BclI TGATCA 1 cut(s) 64
BfaI CTAG 1 cut(s) 158
BfmI CTRYAG 1 cut(s) 150
BisI GCNGC 4 cut(s) 6, 30, 95, 131
BlsI GCNGC 4 cut(s) 7, 31, 96, 132
Bme1390I CCNGG 1 cut(s) 81
BmiI GGNNCC 1 cut(s) 37
BmrFI CCNGG 1 cut(s) 81
BmsI GCATC 1 cut(s) 133
BpmI CTGGAG 1 cut(s) 30
BsaJI CCNNGG 1 cut(s) 51
BseBI CCWGG 1 cut(s) 81
BseDI CCNNGG 1 cut(s) 51
BseRI GAGGAG 1 cut(s) 140
BseXI GCAGC 3 cut(s) 16, 81, 142
Bsp143I GATC 1 cut(s) 64
BspLI GGNNCC 1 cut(s) 37
BspMAI CTGCAG 1 cut(s) 154
BssECI CCNNGG 1 cut(s) 51
BssMI GATC 1 cut(s) 64
BssT1I CCWWGG 1 cut(s) 51
Bst2UI CCWGG 1 cut(s) 81
BstC8I GCNNGC 1 cut(s) 99
BstKTI GATC 1 cut(s) 67
BstMBI GATC 1 cut(s) 64
BstNI CCWGG 1 cut(s) 81
BstSCI CCNGG 1 cut(s) 79
BstSFI CTRYAG 1 cut(s) 150
BstV1I GCAGC 3 cut(s) 16, 81, 142
Cac8I GCNNGC 1 cut(s) 99
CviAII CATG 1 cut(s) 168
CviJI RGCY 4 cut(s) 5, 29, 94, 133
CviKI_1 RGCY 4 cut(s) 5, 29, 94, 133
DpnI GATC 1 cut(s) 66
DpnII GATC 1 cut(s) 64
Eco130I CCWWGG 1 cut(s) 51
EcoRII CCWGG 1 cut(s) 79
EcoT14I CCWWGG 1 cut(s) 51
ErhI CCWWGG 1 cut(s) 51
FaeI CATG 1 cut(s) 171
FaiI YATR 2 cut(s) 26, 169
FatI CATG 1 cut(s) 167
FbaI TGATCA 1 cut(s) 64
Fnu4HI GCNGC 4 cut(s) 6, 30, 95, 131
Fsp4HI GCNGC 4 cut(s) 6, 30, 95, 131
FspBI CTAG 1 cut(s) 158
GluI GCNGC 4 cut(s) 6, 30, 95, 131
GsuI CTGGAG 1 cut(s) 30
Hin1II CATG 1 cut(s) 171
HinfI GANTC 1 cut(s) 136
HphI GGTGA 1 cut(s) 96
Hpy166II GTNNAC 1 cut(s) 164
Hpy188III TCNNGA 1 cut(s) 140
Hpy8I GTNNAC 1 cut(s) 164
HpyCH4V TGCA 1 cut(s) 152
Hsp92II CATG 1 cut(s) 171
Ksp22I TGATCA 1 cut(s) 64
Kzo9I GATC 1 cut(s) 64
LmnI GCTCC 1 cut(s) 127
LpnPI CCDG 4 cut(s) 18, 66, 93, 138
Lsp1109I GCAGC 3 cut(s) 16, 81, 142
LweI GCATC 1 cut(s) 133
MaeI CTAG 1 cut(s) 158
MalI GATC 1 cut(s) 66
MboI GATC 1 cut(s) 64
MlyI GAGTC 1 cut(s) 145
MnlI CCTC 1 cut(s) 118
MseI TTAA 2 cut(s) 41, 120
MslI CAYNNNNRTG 1 cut(s) 53
MspR9I CCNGG 1 cut(s) 81
MvaI CCWGG 1 cut(s) 81
NdeII GATC 1 cut(s) 64
NlaIII CATG 1 cut(s) 171
NlaIV GGNNCC 1 cut(s) 37
NmeAIII GCCGAG 1 cut(s) 159
OliI CACNNNNGTG 1 cut(s) 53
PkrI GCNGC 4 cut(s) 7, 31, 96, 132
PleI GAGTC 1 cut(s) 144
PpsI GAGTC 1 cut(s) 144
Psp6I CCWGG 1 cut(s) 79
PspGI CCWGG 1 cut(s) 79
PspN4I GGNNCC 1 cut(s) 37
PstI CTGCAG 1 cut(s) 154
RseI CAYNNNNRTG 1 cut(s) 53
SaqAI TTAA 2 cut(s) 41, 120
SatI GCNGC 4 cut(s) 6, 30, 95, 131
Sau3AI GATC 1 cut(s) 64
SchI GAGTC 1 cut(s) 145
ScrFI CCNGG 1 cut(s) 81
SetI ASST 5 cut(s) 31, 41, 57, 96, 163
SfaNI GCATC 1 cut(s) 133
SfcI CTRYAG 1 cut(s) 150
SgeI CNNG 9 cut(s) 21, 45, 64, 92, 93, 110, 147, 152, 165
SmiMI CAYNNNNRTG 1 cut(s) 53
SspMI CTAG 1 cut(s) 158
StyD4I CCNGG 1 cut(s) 79
StyI CCWWGG 1 cut(s) 51
Tru1I TTAA 2 cut(s) 41, 120
Tru9I TTAA 2 cut(s) 41, 120
TseI GCWGC 4 cut(s) 5, 29, 94, 130
XspI CTAG 1 cut(s) 158
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.