RchiOBHm_Chr3g0479081

PHD finger protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
24719526 .. 24720785
1260 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 186 bp
ATGAATGGAGTTGATGCTGGAGCAGCTTACAATCCTCAAACCGTTAAAGAGATTTTCAGAGATTTCAGGGGCTGCAGAATTAGCTTGATCAAGGCCCTAACTACTGGTCTTTTACCTATTCCTTTATTCAATTTCTGCTCAGTAGCTTCTACTTTGCCTTTTGAGAACACCCTGAAATGTAATTGA

Protein Analysis

61

Amino Acids

6.68

Weight (kDa)

8.61

Isoelectric Point (pI)

7.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024703)

Species Orthologous Gene IDs
pyrus_communis pycom15g39170
rosa_chinensis RchiOBHm_Chr3g0479081
rosa_samantha Rh7AG319900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 130
AluBI AGCT 3 cut(s) 26, 84, 146
AluI AGCT 3 cut(s) 26, 84, 146
AlwNI CAGNNNCTG 1 cut(s) 72
AoxI GGCC 1 cut(s) 93
ApeKI GCWGC 2 cut(s) 23, 72
AspS9I GGNCC 1 cut(s) 94
BbvI GCAGC 2 cut(s) 35, 59
BclI TGATCA 1 cut(s) 87
BfmI CTRYAG 1 cut(s) 73
BisI GCNGC 2 cut(s) 24, 73
BlsI GCNGC 2 cut(s) 25, 74
BmgT120I GGNCC 1 cut(s) 94
BmsI GCATC 1 cut(s) 4
BpmI CTGGAG 1 cut(s) 39
Bse1I ACTGG 1 cut(s) 109
BseMII CTCAG 1 cut(s) 153
BseNI ACTGG 1 cut(s) 109
BseXI GCAGC 2 cut(s) 35, 59
BshFI GGCC 1 cut(s) 95
BsnI GGCC 1 cut(s) 95
Bsp143I GATC 1 cut(s) 87
BspANI GGCC 1 cut(s) 95
BspCNI CTCAG 1 cut(s) 152
BspMAI CTGCAG 1 cut(s) 77
BsrI ACTGG 1 cut(s) 109
BssMI GATC 1 cut(s) 87
Bst4CI ACNGT 1 cut(s) 43
BstDEI CTNAG 1 cut(s) 139
BstKTI GATC 1 cut(s) 90
BstMBI GATC 1 cut(s) 87
BstMWI GCNNNNNNNGC 2 cut(s) 23, 81
BstSFI CTRYAG 1 cut(s) 73
BstV1I GCAGC 2 cut(s) 35, 59
BsuRI GGCC 1 cut(s) 95
CaiI CAGNNNCTG 1 cut(s) 72
Cfr13I GGNCC 1 cut(s) 94
CviJI RGCY 5 cut(s) 26, 72, 84, 95, 146
CviKI_1 RGCY 5 cut(s) 26, 72, 84, 95, 146
DdeI CTNAG 1 cut(s) 139
DpnI GATC 1 cut(s) 89
DpnII GATC 1 cut(s) 87
EcoO109I RGGNCCY 1 cut(s) 94
FbaI TGATCA 1 cut(s) 87
Fnu4HI GCNGC 2 cut(s) 24, 73
Fsp4HI GCNGC 2 cut(s) 24, 73
GluI GCNGC 2 cut(s) 24, 73
GsuI CTGGAG 1 cut(s) 39
HaeIII GGCC 1 cut(s) 95
Hpy188I TCNGA 1 cut(s) 59
HpyCH4III ACNGT 1 cut(s) 43
HpyCH4V TGCA 1 cut(s) 75
HpyF10VI GCNNNNNNNGC 2 cut(s) 23, 81
HpyF3I CTNAG 1 cut(s) 139
Ksp22I TGATCA 1 cut(s) 87
Kzo9I GATC 1 cut(s) 87
LmnI GCTCC 1 cut(s) 20
LpnPI CCDG 3 cut(s) 3, 52, 90
Lsp1109I GCAGC 2 cut(s) 35, 59
LweI GCATC 1 cut(s) 4
MalI GATC 1 cut(s) 89
MboI GATC 1 cut(s) 87
MluCI AATT 3 cut(s) 78, 130, 181
MnlI CCTC 1 cut(s) 45
MseI TTAA 1 cut(s) 45
MwoI GCNNNNNNNGC 2 cut(s) 23, 81
NdeII GATC 1 cut(s) 87
PkrI GCNGC 2 cut(s) 25, 74
PspPI GGNCC 1 cut(s) 94
PstI CTGCAG 1 cut(s) 77
PstNI CAGNNNCTG 1 cut(s) 72
SaqAI TTAA 1 cut(s) 45
SatI GCNGC 2 cut(s) 24, 73
Sau3AI GATC 1 cut(s) 87
Sau96I GGNCC 1 cut(s) 94
SetI ASST 4 cut(s) 28, 86, 118, 148
SfaNI GCATC 1 cut(s) 4
SfcI CTRYAG 1 cut(s) 73
SgeI CNNG 5 cut(s) 30, 79, 97, 103, 117
Sse9I AATT 3 cut(s) 78, 130, 181
TaaI ACNGT 1 cut(s) 43
TasI AATT 3 cut(s) 78, 130, 181
Tru1I TTAA 1 cut(s) 45
Tru9I TTAA 1 cut(s) 45
TseI GCWGC 2 cut(s) 23, 72
TspDTI ATGAA 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.