RchiOBHm_Chr3g0481601

Calcium-dependent protein kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
27669678 .. 27670510
833 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 270 bp
ATGGCTCCCGAGGTGCTGAGGCGCAATTATGGTCGTGAAGTTGATGTTTGGAGTGCTGGAGTTATACTTTACATTTTACTTTGTGGTGTTCCACCTTTCTGGGCAGAAACTGAACAGGGAATTGCACAAGCAATTATACGGTCTGTTGTAGATTTTAAGAGGGACCCCTGGCCTAAGGTTTCTGATAATGCAAAAGACCTTGTGAAGAAGATGCTTAATCCTGACCCGAAGCAGAGGCTTACAGCTCAGCAAGTTCTAGATCATATTTGA

Protein Analysis

89

Amino Acids

10.16

Weight (kDa)

7.88

Isoelectric Point (pI)

49.42

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pkinase PF00069 1 - 88 1.8e-24 Protein kinase domain
PK_Tyr_Ser-Thr PF07714 1 - 88 3.5e-06 Protein tyrosine and serine/threonine kinase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021847)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G17890
rosa_chinensis RchiOBHm_Chr3g0481601
rosa_multiflora Rmu_ssc0000188.1_g000001
rosa_samantha Rh6BG466200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjnI CCWGG 1 cut(s) 167
AluBI AGCT 1 cut(s) 245
AluI AGCT 1 cut(s) 245
AlwNI CAGNNNCTG 1 cut(s) 110
Ama87I CYCGRG 1 cut(s) 8
AoxI GGCC 1 cut(s) 170
AspLEI GCGC 1 cut(s) 24
AspS9I GGNCC 1 cut(s) 163
AvaI CYCGRG 1 cut(s) 8
AvaII GGWCC 1 cut(s) 163
AxyI CCTNAGG 1 cut(s) 174
BbvCI CCTCAGC 1 cut(s) 17
BciT130I CCWGG 1 cut(s) 169
BfaI CTAG 1 cut(s) 257
BlpI GCTNAGC 1 cut(s) 246
Bme1390I CCNGG 1 cut(s) 169
Bme18I GGWCC 1 cut(s) 163
BmeT110I CYCGRG 1 cut(s) 8
BmgT120I GGNCC 1 cut(s) 163
BmiI GGNNCC 3 cut(s) 6, 164, 165
BmrFI CCNGG 1 cut(s) 169
BmsI GCATC 1 cut(s) 201
BpmI CTGGAG 1 cut(s) 78
Bpu10I CCTNAGC 1 cut(s) 17
Bpu1102I GCTNAGC 1 cut(s) 246
BsaJI CCNNGG 2 cut(s) 9, 167
Bse21I CCTNAGG 1 cut(s) 174
BseBI CCWGG 1 cut(s) 169
BseDI CCNNGG 2 cut(s) 9, 167
BseMII CTCAG 2 cut(s) 8, 260
BshFI GGCC 1 cut(s) 172
BsiHKCI CYCGRG 1 cut(s) 8
BslFI GGGAC 1 cut(s) 176
BsmFI GGGAC 1 cut(s) 176
BsnI GGCC 1 cut(s) 172
BsoBI CYCGRG 1 cut(s) 8
Bsp143I GATC 1 cut(s) 259
Bsp1720I GCTNAGC 1 cut(s) 246
BspANI GGCC 1 cut(s) 172
BspCNI CTCAG 2 cut(s) 9, 259
BspLI GGNNCC 3 cut(s) 6, 164, 165
BssECI CCNNGG 2 cut(s) 9, 167
BssMI GATC 1 cut(s) 259
Bst2UI CCWGG 1 cut(s) 169
Bst4CI ACNGT 1 cut(s) 141
BstDEI CTNAG 3 cut(s) 17, 174, 246
BstHHI GCGC 1 cut(s) 24
BstKTI GATC 1 cut(s) 262
BstMBI GATC 1 cut(s) 259
BstNI CCWGG 1 cut(s) 169
BstSCI CCNGG 1 cut(s) 167
BstXI CCANNNNNNTGG 1 cut(s) 99
Bsu36I CCTNAGG 1 cut(s) 174
BsuRI GGCC 1 cut(s) 172
CaiI CAGNNNCTG 1 cut(s) 110
CfoI GCGC 1 cut(s) 24
Cfr13I GGNCC 1 cut(s) 163
CviJI RGCY 4 cut(s) 5, 172, 238, 245
CviKI_1 RGCY 4 cut(s) 5, 172, 238, 245
DdeI CTNAG 3 cut(s) 17, 174, 246
DpnI GATC 1 cut(s) 261
DpnII GATC 1 cut(s) 259
Eco47I GGWCC 1 cut(s) 163
Eco81I CCTNAGG 1 cut(s) 174
Eco88I CYCGRG 1 cut(s) 8
EcoO109I RGGNCCY 1 cut(s) 163
EcoRII CCWGG 1 cut(s) 167
FaiI YATR 4 cut(s) 30, 65, 137, 264
FaqI GGGAC 1 cut(s) 176
FspBI CTAG 1 cut(s) 257
GlaI GCGC 1 cut(s) 23
GsuI CTGGAG 1 cut(s) 78
HaeIII GGCC 1 cut(s) 172
HhaI GCGC 1 cut(s) 24
Hin6I GCGC 1 cut(s) 22
HinP1I GCGC 1 cut(s) 22
Hpy188I TCNGA 1 cut(s) 184
Hpy188III TCNNGA 4 cut(s) 8, 35, 221, 257
HpyCH4III ACNGT 1 cut(s) 141
HpyCH4V TGCA 2 cut(s) 125, 191
HpyF3I CTNAG 3 cut(s) 17, 174, 246
HspAI GCGC 1 cut(s) 22
KflI GGGWCCC 1 cut(s) 163
Kzo9I GATC 1 cut(s) 259
LmnI GCTCC 1 cut(s) 10
LpnPI CCDG 6 cut(s) 42, 85, 101, 154, 181, 234
LweI GCATC 1 cut(s) 201
MaeI CTAG 1 cut(s) 257
MalI GATC 1 cut(s) 261
MboI GATC 1 cut(s) 259
MboII GAAGA 2 cut(s) 217, 220
MluCI AATT 3 cut(s) 25, 120, 132
MnlI CCTC 4 cut(s) 4, 12, 153, 228
MseI TTAA 2 cut(s) 156, 216
MspR9I CCNGG 1 cut(s) 169
MvaI CCWGG 1 cut(s) 169
NdeII GATC 1 cut(s) 259
NlaIV GGNNCC 3 cut(s) 6, 164, 165
PpuMI RGGWCCY 1 cut(s) 163
Psp5II RGGWCCY 1 cut(s) 163
Psp6I CCWGG 1 cut(s) 167
PspGI CCWGG 1 cut(s) 167
PspN4I GGNNCC 3 cut(s) 6, 164, 165
PspPI GGNCC 1 cut(s) 163
PspPPI RGGWCCY 1 cut(s) 163
PstNI CAGNNNCTG 1 cut(s) 110
SaqAI TTAA 2 cut(s) 156, 216
Sau3AI GATC 1 cut(s) 259
Sau96I GGNCC 1 cut(s) 163
ScrFI CCNGG 1 cut(s) 169
SetI ASST 5 cut(s) 15, 97, 180, 201, 247
SfaNI GCATC 1 cut(s) 201
SinI GGWCC 1 cut(s) 163
Sse9I AATT 3 cut(s) 25, 120, 132
SspMI CTAG 1 cut(s) 257
StyD4I CCNGG 1 cut(s) 167
TaaI ACNGT 1 cut(s) 141
TasI AATT 3 cut(s) 25, 120, 132
Tru1I TTAA 2 cut(s) 156, 216
Tru9I TTAA 2 cut(s) 156, 216
VpaK11BI GGWCC 1 cut(s) 163
XbaI TCTAGA 1 cut(s) 256
XspI CTAG 1 cut(s) 257
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.