Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0021352

Physical Location & Seq

Genomic Coordinates Forward (+)

9025457 .. 9025960

Gene Structure 504 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 159 bp

ATGTTCACTTTCGATTCTATCAATGGGAAAATCGCAATACTTGTAATAACACTTGCGGTTGAAGTTGTCAATCCCAATCCCAACATTCTCAATGGCACGAAGCTCTCACTCAAAATGCATAACACCAAATCGAGTGACATCCTCGATCGGAATCGTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0001101 GO:0002218 GO:0002252 GO:0002253 GO:0002376 GO:0002682 GO:0002684 GO:0003674 GO:0004888 GO:0005215 GO:0005216 GO:0005261 GO:0005262 GO:0005575 GO:0005623 GO:0005886 GO:0006810 GO:0006811 GO:0006812 GO:0006816 GO:0006950 GO:0006952 GO:0006955 GO:0007154 GO:0007165 GO:0007267 GO:0008066 GO:0008150 GO:0008324 GO:0009605 GO:0009607 GO:0009611 GO:0009617 GO:0009682 GO:0009719 GO:0009725 GO:0009753 GO:0009755 GO:0009864 GO:0009867 GO:0009987 GO:0010033 GO:0010243 GO:0015075 GO:0015085 GO:0015267 GO:0015318 GO:0016020 GO:0019722 GO:0019932 GO:0022803 GO:0022838 GO:0022857 GO:0022890 GO:0023052 GO:0030001 GO:0031347 GO:0031349 GO:0032870 GO:0034220 GO:0035556 GO:0038023 GO:0042221 GO:0042742 GO:0043200 GO:0043207 GO:0044464 GO:0045087 GO:0045088 GO:0045089 GO:0046873 GO:0048518 GO:0048583 GO:0048584 GO:0050776 GO:0050778 GO:0050789 GO:0050794 GO:0050896 GO:0051179 GO:0051234 GO:0051704 GO:0051707 GO:0051716 GO:0055085 GO:0060089 GO:0065007 GO:0070588 GO:0070838 GO:0070887 GO:0071229 GO:0071230 GO:0071310 GO:0071395 GO:0071417 GO:0071495 GO:0071944 GO:0072511 GO:0080134 GO:0098542 GO:0098655 GO:0098660 GO:0098662 GO:1901698 GO:1901699 GO:1901700 GO:1901701

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

ANF_receptor Lig_chan SBP_bac_3

Protein Analysis

52

Amino Acids

5.77

Weight (kDa)

9.52

Isoelectric Point (pI)

47.6

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021352)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr2g0096131
rosa_roxburghii	Rroxscaffold_2G00145060
rosa_rugosa	Rorug02G0065000.1 Rorug02G0065100.1 Rorug02G0065200.1

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	56
AgsI	TTSAA	1 cut(s)	62
AluBI	AGCT	1 cut(s)	103
AluI	AGCT	1 cut(s)	103
BsaBI	GATNNNNATC	1 cut(s)	150
Bse8I	GATNNNNATC	1 cut(s)	150
BseGI	GGATG	1 cut(s)	138
BseJI	GATNNNNATC	1 cut(s)	150
Bsh1285I	CGRYCG	1 cut(s)	148
BsiEI	CGRYCG	1 cut(s)	148
Bsp143I	GATC	1 cut(s)	145
BspACI	CCGC	1 cut(s)	56
BssMI	GATC	1 cut(s)	145
BstF5I	GGATG	1 cut(s)	138
BstKTI	GATC	1 cut(s)	148
BstMBI	GATC	1 cut(s)	145
BstMCI	CGRYCG	1 cut(s)	148
BtsCI	GGATG	1 cut(s)	138
CviJI	RGCY	1 cut(s)	103
CviKI_1	RGCY	1 cut(s)	103
DpnI	GATC	1 cut(s)	147
DpnII	GATC	1 cut(s)	145
EcoT22I	ATGCAT	1 cut(s)	120
FaiI	YATR	1 cut(s)	120
FokI	GGATG	1 cut(s)	125
HinfI	GANTC	2 cut(s)	14, 151
Hpy166II	GTNNAC	1 cut(s)	6
Hpy188I	TCNGA	1 cut(s)	150
Hpy8I	GTNNAC	1 cut(s)	6
HpyCH4V	TGCA	1 cut(s)	118
Kzo9I	GATC	1 cut(s)	145
MaeIII	GTNAC	1 cut(s)	134
MalI	GATC	1 cut(s)	147
MboI	GATC	1 cut(s)	145
MnlI	CCTC	1 cut(s)	152
Mph1103I	ATGCAT	1 cut(s)	120
NdeII	GATC	1 cut(s)	145
NmuCI	GTSAC	1 cut(s)	134
NsiI	ATGCAT	1 cut(s)	120
PfeI	GAWTC	2 cut(s)	14, 151
Ple19I	CGATCG	1 cut(s)	148
PvuI	CGATCG	1 cut(s)	148
Sau3AI	GATC	1 cut(s)	145
SetI	ASST	1 cut(s)	105
SgeI	CNNG	5 cut(s)	53, 65, 109, 144, 155
SsiI	CCGC	1 cut(s)	56
TaqI	TCGA	3 cut(s)	12, 131, 144
TfiI	GAWTC	2 cut(s)	14, 151
TseFI	GTSAC	1 cut(s)	134
Tsp45I	GTSAC	1 cut(s)	134
Zsp2I	ATGCAT	1 cut(s)	120

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.