RchiOBHm_Chr2g0113391

Cyclin-dependent kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
25564929 .. 25565741
813 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 228 bp
ATGAAGCAGTTGTTAACTGGGCTCCATTACTGTCATGTTAATCAAGTACTTCATCGCGACATGAAAGGTTCTAATCTTTTGTTAGATAATGAGGGAAAATTGAAGCTAGCAGAATTTGGGCTCGCAAAATCCTTTGCTACCAACCATGATGGGCAGCTTACAAATCGTGTTATTACATTGTGGTATAGGCCCTCAGAGTTGCTGCTTGGAGCTACAAAGTGTGGATGA

Protein Analysis

75

Amino Acids

8.42

Weight (kDa)

9.1

Isoelectric Point (pI)

17.89

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pkinase PF00069 1 - 70 3.9e-21 Protein kinase domain
PK_Tyr_Ser-Thr PF07714 2 - 62 1.1e-08 Protein tyrosine and serine/threonine kinase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024356)

Species Orthologous Gene IDs
malus_domestica MD16G1175100.v1.1
rosa_chinensis RchiOBHm_Chr2g0113391
rosa_roxburghii Rroxscaffold_2G00125160

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 57
AcsI RAATTY 1 cut(s) 113
AfaI GTAC 1 cut(s) 48
AgsI TTSAA 1 cut(s) 103
AluBI AGCT 3 cut(s) 106, 157, 212
AluI AGCT 3 cut(s) 106, 157, 212
AoxI GGCC 1 cut(s) 188
ApeKI GCWGC 2 cut(s) 154, 202
ApoI RAATTY 1 cut(s) 113
AspS9I GGNCC 1 cut(s) 189
AsuNHI GCTAGC 1 cut(s) 106
BanII GRGCYC 2 cut(s) 24, 123
BbvI GCAGC 2 cut(s) 166, 189
BccI CCATC 1 cut(s) 143
BfaI CTAG 1 cut(s) 107
BisI GCNGC 2 cut(s) 155, 203
BlsI GCNGC 2 cut(s) 156, 204
BmcAI AGTACT 1 cut(s) 48
BmgT120I GGNCC 1 cut(s) 189
BmiI GGNNCC 1 cut(s) 23
BmrI ACTGGG 1 cut(s) 27
BmtI GCTAGC 1 cut(s) 110
BmuI ACTGGG 1 cut(s) 27
Bse1I ACTGG 1 cut(s) 22
BseMII CTCAG 1 cut(s) 207
BseNI ACTGG 1 cut(s) 22
BseXI GCAGC 2 cut(s) 166, 189
Bsh1236I CGCG 1 cut(s) 57
BshFI GGCC 1 cut(s) 190
BsnI GGCC 1 cut(s) 190
Bsp1286I GDGCHC 2 cut(s) 24, 123
Bsp68I TCGCGA 1 cut(s) 57
BspANI GGCC 1 cut(s) 190
BspCNI CTCAG 1 cut(s) 206
BspFNI CGCG 1 cut(s) 57
BspLI GGNNCC 1 cut(s) 23
BspOI GCTAGC 1 cut(s) 110
BsrI ACTGG 1 cut(s) 22
Bst4CI ACNGT 1 cut(s) 32
BstC8I GCNNGC 2 cut(s) 108, 123
BstDEI CTNAG 1 cut(s) 193
BstFNI CGCG 1 cut(s) 57
BstUI CGCG 1 cut(s) 57
BstV1I GCAGC 2 cut(s) 166, 189
BsuRI GGCC 1 cut(s) 190
BtgZI GCGATG 1 cut(s) 38
BtuMI TCGCGA 1 cut(s) 57
Cac8I GCNNGC 2 cut(s) 108, 123
Cfr13I GGNCC 1 cut(s) 189
Csp6I GTAC 1 cut(s) 47
CviAII CATG 3 cut(s) 35, 61, 146
CviJI RGCY 6 cut(s) 22, 106, 121, 157, 190, 212
CviKI_1 RGCY 6 cut(s) 22, 106, 121, 157, 190, 212
CviQI GTAC 1 cut(s) 47
DdeI CTNAG 1 cut(s) 193
Eco24I GRGCYC 2 cut(s) 24, 123
EcoO109I RGGNCCY 1 cut(s) 189
EcoT38I GRGCYC 2 cut(s) 24, 123
FaeI CATG 3 cut(s) 38, 64, 149
FaiI YATR 4 cut(s) 36, 62, 147, 186
FatI CATG 3 cut(s) 34, 60, 145
Fnu4HI GCNGC 2 cut(s) 155, 203
FriOI GRGCYC 2 cut(s) 24, 123
Fsp4HI GCNGC 2 cut(s) 155, 203
FspBI CTAG 1 cut(s) 107
GluI GCNGC 2 cut(s) 155, 203
HaeIII GGCC 1 cut(s) 190
Hin1II CATG 3 cut(s) 38, 64, 149
HincII GTYRAC 1 cut(s) 15
HindII GTYRAC 1 cut(s) 15
HpaI GTTAAC 1 cut(s) 15
Hpy166II GTNNAC 1 cut(s) 15
Hpy188I TCNGA 1 cut(s) 196
Hpy188III TCNNGA 1 cut(s) 56
Hpy8I GTNNAC 1 cut(s) 15
HpyCH4III ACNGT 1 cut(s) 32
HpyF3I CTNAG 1 cut(s) 193
Hsp92II CATG 3 cut(s) 38, 64, 149
KspAI GTTAAC 1 cut(s) 15
LmnI GCTCC 2 cut(s) 27, 209
LpnPI CCDG 1 cut(s) 3
Lsp1109I GCAGC 2 cut(s) 166, 189
MaeI CTAG 1 cut(s) 107
MhlI GDGCHC 2 cut(s) 24, 123
MluCI AATT 2 cut(s) 98, 113
MnlI CCTC 2 cut(s) 85, 202
MseI TTAA 2 cut(s) 14, 39
MvnI CGCG 1 cut(s) 57
NheI GCTAGC 1 cut(s) 106
NlaIII CATG 3 cut(s) 38, 64, 149
NlaIV GGNNCC 1 cut(s) 23
NruI TCGCGA 1 cut(s) 57
PkrI GCNGC 2 cut(s) 156, 204
PspN4I GGNNCC 1 cut(s) 23
PspPI GGNCC 1 cut(s) 189
RruI TCGCGA 1 cut(s) 57
RsaI GTAC 1 cut(s) 48
RsaNI GTAC 1 cut(s) 47
SaqAI TTAA 2 cut(s) 14, 39
SatI GCNGC 2 cut(s) 155, 203
Sau96I GGNCC 1 cut(s) 189
ScaI AGTACT 1 cut(s) 48
SduI GDGCHC 2 cut(s) 24, 123
SetI ASST 4 cut(s) 70, 108, 159, 214
Sse9I AATT 2 cut(s) 98, 113
SspMI CTAG 1 cut(s) 107
TaaI ACNGT 1 cut(s) 32
TasI AATT 2 cut(s) 98, 113
TatI WGTACW 1 cut(s) 46
Tru1I TTAA 2 cut(s) 14, 39
Tru9I TTAA 2 cut(s) 14, 39
TseI GCWGC 2 cut(s) 154, 202
TspDTI ATGAA 3 cut(s) 17, 41, 77
XapI RAATTY 1 cut(s) 113
XspI CTAG 1 cut(s) 107
ZrmI AGTACT 1 cut(s) 48
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.