RchiOBHm_Chr2g0122901

Electron carrier protein. The oxidized form of the cytochrome c heme group can accept an electron from the heme group of the cytochrome c1 subunit of cytochrome reductase. Cytochrome c then transfers this electron to the cytochrome oxidase complex, the final protein carrier in the mitochondrial electron-transport chain

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
36046402 .. 36046661
260 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 165 bp
ATGGCATCGTTCGCTGAAGCTCCACTGGGAGGTGCCAAGGCTGGAGAGAAGATCTTCAAGACCAAGTGCGCTCAGTGCCACACCGTCGACAAAGGCGCCAGCCACAAGCAAGGTTGTGATTATACGGATCTGAGAGTTTTGTACACTTGTGTTCTGATCATTTGA
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

54

Amino Acids

5.79

Weight (kDa)

8.42

Isoelectric Point (pI)

17.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024881)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0122901
rosa_roxburghii Rroxscaffold_3G00239190
rosa_samantha Rh6DG424200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 32, 95
AccI GTMKAC 1 cut(s) 87
AclWI GGATC 1 cut(s) 135
AcuI CTGAAG 1 cut(s) 36
AcyI GRCGYC 1 cut(s) 96
AfaI GTAC 1 cut(s) 143
AfiI CCNNNNNNNGG 1 cut(s) 29
AgsI TTSAA 1 cut(s) 58
AluBI AGCT 1 cut(s) 20
AluI AGCT 1 cut(s) 20
AlwI GGATC 1 cut(s) 135
Asp700I GAANNNNTTC 1 cut(s) 53
AspLEI GCGC 2 cut(s) 71, 98
BanI GGYRCC 2 cut(s) 32, 95
BclI TGATCA 1 cut(s) 156
BfoI RGCGCY 1 cut(s) 99
BglII AGATCT 1 cut(s) 51
BmiI GGNNCC 2 cut(s) 34, 97
BmrI ACTGGG 1 cut(s) 35
BmsI GCATC 1 cut(s) 14
BmuI ACTGGG 1 cut(s) 35
BpmI CTGGAG 1 cut(s) 63
BsaHI GRCGYC 1 cut(s) 96
BsaJI CCNNGG 1 cut(s) 36
Bsc4I CCNNNNNNNGG 1 cut(s) 29
Bse1I ACTGG 1 cut(s) 30
BseDI CCNNGG 1 cut(s) 36
BseLI CCNNNNNNNGG 1 cut(s) 29
BseMII CTCAG 2 cut(s) 86, 122
BseNI ACTGG 1 cut(s) 30
BshNI GGYRCC 2 cut(s) 32, 95
BslI CCNNNNNNNGG 1 cut(s) 29
Bsp1407I TGTACA 1 cut(s) 141
Bsp143I GATC 3 cut(s) 51, 127, 156
BspCNI CTCAG 2 cut(s) 85, 123
BspLI GGNNCC 2 cut(s) 34, 97
BspPI GGATC 1 cut(s) 135
BspT107I GGYRCC 2 cut(s) 32, 95
BsrGI TGTACA 1 cut(s) 141
BsrI ACTGG 1 cut(s) 30
BssECI CCNNGG 1 cut(s) 36
BssMI GATC 3 cut(s) 51, 127, 156
BssNI GRCGYC 1 cut(s) 96
BssT1I CCWWGG 1 cut(s) 36
Bst4CI ACNGT 1 cut(s) 85
BstACI GRCGYC 1 cut(s) 96
BstAUI TGTACA 1 cut(s) 141
BstC8I GCNNGC 1 cut(s) 100
BstDEI CTNAG 2 cut(s) 72, 131
BstH2I RGCGCY 1 cut(s) 99
BstHHI GCGC 2 cut(s) 71, 98
BstKTI GATC 3 cut(s) 54, 130, 159
BstMBI GATC 3 cut(s) 51, 127, 156
BstMWI GCNNNNNNNGC 2 cut(s) 11, 75
BstX2I RGATCY 2 cut(s) 51, 127
BstYI RGATCY 2 cut(s) 51, 127
BtsIMutI CAGTG 2 cut(s) 23, 80
Cac8I GCNNGC 1 cut(s) 100
CfoI GCGC 2 cut(s) 71, 98
Csp6I GTAC 1 cut(s) 142
CviJI RGCY 3 cut(s) 20, 41, 102
CviKI_1 RGCY 3 cut(s) 20, 41, 102
CviQI GTAC 1 cut(s) 142
DdeI CTNAG 2 cut(s) 72, 131
DinI GGCGCC 1 cut(s) 97
DpnI GATC 3 cut(s) 53, 129, 158
DpnII GATC 3 cut(s) 51, 127, 156
Eco130I CCWWGG 1 cut(s) 36
Eco57I CTGAAG 1 cut(s) 36
EcoT14I CCWWGG 1 cut(s) 36
EgeI GGCGCC 1 cut(s) 97
EheI GGCGCC 1 cut(s) 97
ErhI CCWWGG 1 cut(s) 36
FaiI YATR 1 cut(s) 123
FbaI TGATCA 1 cut(s) 156
FblI GTMKAC 1 cut(s) 87
GlaI GCGC 2 cut(s) 70, 97
GsuI CTGGAG 1 cut(s) 63
HaeII RGCGCY 1 cut(s) 99
HhaI GCGC 2 cut(s) 71, 98
Hin1I GRCGYC 1 cut(s) 96
Hin6I GCGC 2 cut(s) 69, 96
HinP1I GCGC 2 cut(s) 69, 96
HincII GTYRAC 1 cut(s) 88
HindII GTYRAC 1 cut(s) 88
Hpy166II GTNNAC 2 cut(s) 88, 144
Hpy188I TCNGA 2 cut(s) 132, 156
Hpy188III TCNNGA 1 cut(s) 58
Hpy8I GTNNAC 2 cut(s) 88, 144
Hpy99I CGWCG 1 cut(s) 89
HpyCH4III ACNGT 1 cut(s) 85
HpyF10VI GCNNNNNNNGC 2 cut(s) 11, 75
HpyF3I CTNAG 2 cut(s) 72, 131
Hsp92I GRCGYC 1 cut(s) 96
HspAI GCGC 2 cut(s) 69, 96
KasI GGCGCC 1 cut(s) 95
Ksp22I TGATCA 1 cut(s) 156
Kzo9I GATC 3 cut(s) 51, 127, 156
LmnI GCTCC 1 cut(s) 25
LpnPI CCDG 3 cut(s) 11, 27, 112
LweI GCATC 1 cut(s) 14
MalI GATC 3 cut(s) 53, 129, 158
MboI GATC 3 cut(s) 51, 127, 156
MboII GAAGA 2 cut(s) 46, 61
MflI RGATCY 2 cut(s) 51, 127
Mly113I GGCGCC 1 cut(s) 96
MnlI CCTC 1 cut(s) 23
MroXI GAANNNNTTC 1 cut(s) 53
MwoI GCNNNNNNNGC 2 cut(s) 11, 75
NarI GGCGCC 1 cut(s) 96
NdeII GATC 3 cut(s) 51, 127, 156
NlaIV GGNNCC 2 cut(s) 34, 97
PdmI GAANNNNTTC 1 cut(s) 53
PluTI GGCGCC 1 cut(s) 99
PspN4I GGNNCC 2 cut(s) 34, 97
PsuI RGATCY 2 cut(s) 51, 127
RsaI GTAC 1 cut(s) 143
RsaNI GTAC 1 cut(s) 142
SalI GTCGAC 1 cut(s) 86
Sau3AI GATC 3 cut(s) 51, 127, 156
SetI ASST 3 cut(s) 22, 34, 115
SfaNI GCATC 1 cut(s) 14
SfoI GGCGCC 1 cut(s) 97
SgeI CNNG 9 cut(s) 38, 49, 54, 70, 76, 111, 118, 122, 159
SspDI GGCGCC 1 cut(s) 95
StyI CCWWGG 1 cut(s) 36
TaaI ACNGT 1 cut(s) 85
TaqI TCGA 1 cut(s) 87
TatI WGTACW 1 cut(s) 141
TscAI CASTG 2 cut(s) 30, 80
TspGWI ACGGA 1 cut(s) 140
TspRI CASTG 2 cut(s) 30, 80
XmiI GTMKAC 1 cut(s) 87
XmnI GAANNNNTTC 1 cut(s) 53
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.