Rroxscaffold_3G00239190

Electron carrier protein. The oxidized form of the cytochrome c heme group can accept an electron from the heme group of the cytochrome c1 subunit of cytochrome reductase. Cytochrome c then transfers this electron to the cytochrome oxidase complex, the final protein carrier in the mitochondrial electron-transport chain

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Forward (+)
28899540 .. 28908336
8797 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00239190.1

Sequence Viewer

Length: 153 bp
ATGGCGTCGTTCGCTGAAGCTCCACCGGGAGGTGCCAAGGCCGGAGAGAAGATCTTCGGGACCAAGTGCGCTCGGTGCCACAACGTCGACAAAGGCGCCAGCCACGAGCAAACTAGAAAAGTATCCAAGCTTTTGTTTGGCATGAACTCATAA
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

50

Amino Acids

5.26

Weight (kDa)

9.51

Isoelectric Point (pI)

19.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024881)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0122901
rosa_roxburghii Rroxscaffold_3G00239190
rosa_samantha Rh6DG424200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 3 cut(s) 32, 75, 95
AccI GTMKAC 1 cut(s) 87
AcuI CTGAAG 1 cut(s) 36
AcyI GRCGYC 2 cut(s) 5, 96
AfiI CCNNNNNNNGG 1 cut(s) 29
AluBI AGCT 2 cut(s) 20, 130
AluI AGCT 2 cut(s) 20, 130
AoxI GGCC 1 cut(s) 39
Asp700I GAANNNNTTC 1 cut(s) 53
AspLEI GCGC 2 cut(s) 71, 98
AspS9I GGNCC 1 cut(s) 60
AsuC2I CCSGG 1 cut(s) 27
AvaII GGWCC 1 cut(s) 60
BanI GGYRCC 3 cut(s) 32, 75, 95
BauI CACGAG 1 cut(s) 104
BciVI GTATCC 1 cut(s) 133
BcnI CCSGG 1 cut(s) 27
BfaI CTAG 1 cut(s) 114
BfoI RGCGCY 1 cut(s) 99
BfuI GTATCC 1 cut(s) 133
BglII AGATCT 1 cut(s) 51
Bme1390I CCNGG 1 cut(s) 27
Bme18I GGWCC 1 cut(s) 60
BmgT120I GGNCC 1 cut(s) 60
BmiI GGNNCC 4 cut(s) 34, 61, 77, 97
BmrFI CCNGG 1 cut(s) 27
BpuMI CCSGG 1 cut(s) 27
BsaHI GRCGYC 2 cut(s) 5, 96
BsaJI CCNNGG 1 cut(s) 36
Bsc4I CCNNNNNNNGG 1 cut(s) 29
BseDI CCNNGG 1 cut(s) 36
BseLI CCNNNNNNNGG 1 cut(s) 29
BshFI GGCC 1 cut(s) 41
BshNI GGYRCC 3 cut(s) 32, 75, 95
BsiSI CCGG 2 cut(s) 26, 42
BslFI GGGAC 1 cut(s) 73
BslI CCNNNNNNNGG 1 cut(s) 29
BsmFI GGGAC 1 cut(s) 73
BsnI GGCC 1 cut(s) 41
Bsp143I GATC 1 cut(s) 51
BspANI GGCC 1 cut(s) 41
BspLI GGNNCC 4 cut(s) 34, 61, 77, 97
BspT107I GGYRCC 3 cut(s) 32, 75, 95
BssECI CCNNGG 1 cut(s) 36
BssMI GATC 1 cut(s) 51
BssNI GRCGYC 2 cut(s) 5, 96
BssSI CACGAG 1 cut(s) 104
BssT1I CCWWGG 1 cut(s) 36
Bst2BI CACGAG 1 cut(s) 104
BstACI GRCGYC 2 cut(s) 5, 96
BstC8I GCNNGC 1 cut(s) 100
BstH2I RGCGCY 1 cut(s) 99
BstHHI GCGC 2 cut(s) 71, 98
BstKTI GATC 1 cut(s) 54
BstMBI GATC 1 cut(s) 51
BstMWI GCNNNNNNNGC 2 cut(s) 11, 75
BstSCI CCNGG 1 cut(s) 25
BstX2I RGATCY 1 cut(s) 51
BstYI RGATCY 1 cut(s) 51
BsuI GTATCC 1 cut(s) 133
BsuRI GGCC 1 cut(s) 41
Cac8I GCNNGC 1 cut(s) 100
CfoI GCGC 2 cut(s) 71, 98
Cfr13I GGNCC 1 cut(s) 60
CviAII CATG 1 cut(s) 142
CviJI RGCY 4 cut(s) 20, 41, 102, 130
CviKI_1 RGCY 4 cut(s) 20, 41, 102, 130
DinI GGCGCC 1 cut(s) 97
DpnI GATC 1 cut(s) 53
DpnII GATC 1 cut(s) 51
Eco130I CCWWGG 1 cut(s) 36
Eco47I GGWCC 1 cut(s) 60
Eco57I CTGAAG 1 cut(s) 36
EcoT14I CCWWGG 1 cut(s) 36
EgeI GGCGCC 1 cut(s) 97
EheI GGCGCC 1 cut(s) 97
ErhI CCWWGG 1 cut(s) 36
FaeI CATG 1 cut(s) 145
FaiI YATR 2 cut(s) 143, 151
FaqI GGGAC 1 cut(s) 73
FatI CATG 1 cut(s) 141
FblI GTMKAC 1 cut(s) 87
FspBI CTAG 1 cut(s) 114
GlaI GCGC 2 cut(s) 70, 97
HaeII RGCGCY 1 cut(s) 99
HaeIII GGCC 1 cut(s) 41
HapII CCGG 2 cut(s) 26, 42
HhaI GCGC 2 cut(s) 71, 98
Hin1I GRCGYC 2 cut(s) 5, 96
Hin1II CATG 1 cut(s) 145
Hin6I GCGC 2 cut(s) 69, 96
HinP1I GCGC 2 cut(s) 69, 96
HincII GTYRAC 1 cut(s) 88
HindII GTYRAC 1 cut(s) 88
HindIII AAGCTT 1 cut(s) 128
HpaII CCGG 2 cut(s) 26, 42
Hpy166II GTNNAC 1 cut(s) 88
Hpy188III TCNNGA 1 cut(s) 58
Hpy8I GTNNAC 1 cut(s) 88
Hpy99I CGWCG 2 cut(s) 10, 89
HpyCH4IV ACGT 1 cut(s) 84
HpyF10VI GCNNNNNNNGC 2 cut(s) 11, 75
HpySE526I ACGT 1 cut(s) 84
Hsp92I GRCGYC 2 cut(s) 5, 96
Hsp92II CATG 1 cut(s) 145
HspAI GCGC 2 cut(s) 69, 96
KasI GGCGCC 1 cut(s) 95
Kzo9I GATC 1 cut(s) 51
LmnI GCTCC 1 cut(s) 25
LpnPI CCDG 3 cut(s) 39, 55, 112
MaeI CTAG 1 cut(s) 114
MaeII ACGT 1 cut(s) 84
MalI GATC 1 cut(s) 53
MboI GATC 1 cut(s) 51
MboII GAAGA 2 cut(s) 46, 61
MflI RGATCY 1 cut(s) 51
Mly113I GGCGCC 1 cut(s) 96
MnlI CCTC 1 cut(s) 23
MroXI GAANNNNTTC 1 cut(s) 53
MspI CCGG 2 cut(s) 26, 42
MspR9I CCNGG 1 cut(s) 27
MwoI GCNNNNNNNGC 2 cut(s) 11, 75
NarI GGCGCC 1 cut(s) 96
NciI CCSGG 1 cut(s) 27
NdeII GATC 1 cut(s) 51
NlaIII CATG 1 cut(s) 145
NlaIV GGNNCC 4 cut(s) 34, 61, 77, 97
PdmI GAANNNNTTC 1 cut(s) 53
PluTI GGCGCC 1 cut(s) 99
PspN4I GGNNCC 4 cut(s) 34, 61, 77, 97
PspPI GGNCC 1 cut(s) 60
PsuI RGATCY 1 cut(s) 51
SalI GTCGAC 1 cut(s) 86
Sau3AI GATC 1 cut(s) 51
Sau96I GGNCC 1 cut(s) 60
ScrFI CCNGG 1 cut(s) 27
SetI ASST 4 cut(s) 22, 34, 87, 132
SfoI GGCGCC 1 cut(s) 97
SinI GGWCC 1 cut(s) 60
SspDI GGCGCC 1 cut(s) 95
SspMI CTAG 1 cut(s) 114
StyD4I CCNGG 1 cut(s) 25
StyI CCWWGG 1 cut(s) 36
TaiI ACGT 1 cut(s) 87
TaqI TCGA 1 cut(s) 87
VpaK11BI GGWCC 1 cut(s) 60
XmiI GTMKAC 1 cut(s) 87
XmnI GAANNNNTTC 1 cut(s) 53
XspI CTAG 1 cut(s) 114
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.