RchiOBHm_Chr2g0136521

Cytochrome B6-F complex subunit 5

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
53895713 .. 53895877
165 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 165 bp
ATGATTGAAGTTTTTCTATTTGGAATCGTCTTGGGTCTAATTCCTATGACTTTGGCTGGATTATTTGTAACTGCATACTTACAATACAGACCTGGTAGCCGTAATACCACAAAACCTACAGTATTTAGAATACTAATCATCCATCTGAAAATATCCAGTATATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

54

Amino Acids

6.06

Weight (kDa)

10.43

Isoelectric Point (pI)

25.01

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PetG PF02529 1 - 33 1.5e-18 Cytochrome B6-F complex subunit 5
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0026884)

Species Orthologous Gene IDs
arabidopsis_thaliana ATCG00600
rosa_chinensis RchiOBHm_Chr2g0136521

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 8
AjnI CCWGG 1 cut(s) 91
Asp700I GAANNNNTTC 1 cut(s) 12
BccI CCATC 1 cut(s) 150
BceAI ACGGC 1 cut(s) 84
BciT130I CCWGG 1 cut(s) 93
BfmI CTRYAG 1 cut(s) 117
Bme1390I CCNGG 1 cut(s) 93
BmrFI CCNGG 1 cut(s) 93
Bse1I ACTGG 1 cut(s) 156
BseBI CCWGG 1 cut(s) 93
BseGI GGATG 1 cut(s) 138
BseNI ACTGG 1 cut(s) 156
BsrI ACTGG 1 cut(s) 156
Bst2UI CCWGG 1 cut(s) 93
Bst4CI ACNGT 1 cut(s) 121
BstF5I GGATG 1 cut(s) 138
BstNI CCWGG 1 cut(s) 93
BstSCI CCNGG 1 cut(s) 91
BstSFI CTRYAG 1 cut(s) 117
BtsCI GGATG 1 cut(s) 138
CsiI ACCWGGT 1 cut(s) 91
CviJI RGCY 2 cut(s) 56, 99
CviKI_1 RGCY 2 cut(s) 56, 99
EcoRII CCWGG 1 cut(s) 91
FaiI YATR 4 cut(s) 47, 76, 161, 163
FokI GGATG 1 cut(s) 125
HinfI GANTC 1 cut(s) 24
Hpy188I TCNGA 1 cut(s) 147
HpyCH4III ACNGT 1 cut(s) 121
HpyCH4V TGCA 1 cut(s) 74
LpnPI CCDG 3 cut(s) 42, 78, 105
MabI ACCWGGT 1 cut(s) 91
MaeIII GTNAC 1 cut(s) 67
MluCI AATT 1 cut(s) 39
MroXI GAANNNNTTC 1 cut(s) 12
MspR9I CCNGG 1 cut(s) 93
MvaI CCWGG 1 cut(s) 93
PdmI GAANNNNTTC 1 cut(s) 12
PfeI GAWTC 1 cut(s) 24
Psp6I CCWGG 1 cut(s) 91
PspGI CCWGG 1 cut(s) 91
ScrFI CCNGG 1 cut(s) 93
SetI ASST 2 cut(s) 94, 118
SexAI ACCWGGT 1 cut(s) 91
SfcI CTRYAG 1 cut(s) 117
SgeI CNNG 4 cut(s) 43, 69, 104, 105
Sse9I AATT 1 cut(s) 39
StyD4I CCNGG 1 cut(s) 91
TaaI ACNGT 1 cut(s) 121
TasI AATT 1 cut(s) 39
TfiI GAWTC 1 cut(s) 24
XmnI GAANNNNTTC 1 cut(s) 12
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.