RchiOBHm_Chr2g0163331

Acts as a Mg(2 ) transporter. Can also transport other divalent cations such as Fe(2 ), Sr(2 ), Ba(2 ), Mn(2 ) and Co(2 ) but to a much less extent than Mg(2 )

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
78865436 .. 78868991
3556 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 153 bp
ATGAGTGTTAAAGCCCTAGGAACTGCTCTAAAATTAACTTTTGAGGGAAAGAATCAGTTAATCTATCCAGAGACATGGTTTTTTATGTTGGTTGTAACTACATGTATCATCACTCAGATGAACTATCTGAACAAGACATTAGACTGCAGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

50

Amino Acids

5.72

Weight (kDa)

7.77

Isoelectric Point (pI)

16.65

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Mg_trans_NIPA PF05653 1 - 48 4e-16 Magnesium transporter NIPA
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024861)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0163331
rosa_roxburghii Rroxscaffold_1G00030020
rosa_samantha Rh5AG335500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflIII ACRYGT 1 cut(s) 101
Alw26I GTCTC 1 cut(s) 65
AspA2I CCTAGG 1 cut(s) 16
AvrII CCTAGG 1 cut(s) 16
BcoDI GTCTC 1 cut(s) 65
BfaI CTAG 1 cut(s) 17
BfmI CTRYAG 1 cut(s) 145
BlnI CCTAGG 1 cut(s) 16
BsaJI CCNNGG 1 cut(s) 16
BseDI CCNNGG 1 cut(s) 16
BseMII CTCAG 1 cut(s) 128
BsmAI GTCTC 1 cut(s) 65
BspCNI CTCAG 1 cut(s) 127
BspMAI CTGCAG 1 cut(s) 149
BssECI CCNNGG 1 cut(s) 16
BssT1I CCWWGG 1 cut(s) 16
BstDEI CTNAG 1 cut(s) 114
BstMAI GTCTC 1 cut(s) 65
BstNSI RCATGY 1 cut(s) 105
BstSFI CTRYAG 1 cut(s) 145
BstXI CCANNNNNNTGG 1 cut(s) 75
CviAII CATG 2 cut(s) 75, 102
CviJI RGCY 1 cut(s) 14
CviKI_1 RGCY 1 cut(s) 14
DdeI CTNAG 1 cut(s) 114
Eco130I CCWWGG 1 cut(s) 16
EcoT14I CCWWGG 1 cut(s) 16
ErhI CCWWGG 1 cut(s) 16
FaeI CATG 2 cut(s) 78, 105
FaiI YATR 3 cut(s) 76, 86, 103
FatI CATG 2 cut(s) 74, 101
FspBI CTAG 1 cut(s) 17
FspEI CC 8 cut(s) 3, 28, 29, 29, 30, 61, 74, 81
Hin1II CATG 2 cut(s) 78, 105
HinfI GANTC 1 cut(s) 52
Hpy188I TCNGA 2 cut(s) 117, 129
Hpy188III TCNNGA 1 cut(s) 68
HpyCH4V TGCA 1 cut(s) 147
HpyF3I CTNAG 1 cut(s) 114
Hsp92II CATG 2 cut(s) 78, 105
LpnPI CCDG 1 cut(s) 81
MaeI CTAG 1 cut(s) 17
MaeIII GTNAC 1 cut(s) 94
MluCI AATT 1 cut(s) 32
MnlI CCTC 1 cut(s) 37
MseI TTAA 4 cut(s) 9, 35, 59, 151
MslI CAYNNNNRTG 1 cut(s) 116
NlaIII CATG 2 cut(s) 78, 105
NspI RCATGY 1 cut(s) 105
PciI ACATGT 1 cut(s) 101
PfeI GAWTC 1 cut(s) 52
PscI ACATGT 1 cut(s) 101
PstI CTGCAG 1 cut(s) 149
RseI CAYNNNNRTG 1 cut(s) 116
SaqAI TTAA 4 cut(s) 9, 35, 59, 151
SfcI CTRYAG 1 cut(s) 145
SgeI CNNG 5 cut(s) 29, 80, 87, 114, 145
SmiMI CAYNNNNRTG 1 cut(s) 116
Sse9I AATT 1 cut(s) 32
SspMI CTAG 1 cut(s) 17
StyI CCWWGG 1 cut(s) 16
TasI AATT 1 cut(s) 32
TfiI GAWTC 1 cut(s) 52
Tru1I TTAA 4 cut(s) 9, 35, 59, 151
Tru9I TTAA 4 cut(s) 9, 35, 59, 151
TspDTI ATGAA 1 cut(s) 134
XceI RCATGY 1 cut(s) 105
XmaJI CCTAGG 1 cut(s) 16
XspI CTAG 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.