Rh5AG335500

Acts as a Mg(2 ) transporter. Can also transport other divalent cations such as Fe(2 ), Sr(2 ), Ba(2 ), Mn(2 ) and Co(2 ) but to a much less extent than Mg(2 )

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
OG0024861
Physical Location & Seq
Forward (+)
53887855 .. 53894492
6638 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG335500.1

Sequence Viewer

Length: 252 bp
ATGCACCACAGGAGCATCCTATCACGAATGTTCTTGAAATATGGAGTATGGCAACTCAACCAGGTAATGAGTGTTAAAGCCCTAGGAACTGCTCTAAAATTAACTTTTGAGGGAAAGAATCAGTTAATCTATCCAGAGACATGGTTTTTTGTGTTGGTTGTAACTACATGTGTCATCACTCAGATGAACTATCTGAACAAGGTAACACCAGCAGGACACCATTCTTATTTTTTAGAGCCTGAGCAGGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Mg_trans_NIPA

Protein Analysis

83

Amino Acids

9.65

Weight (kDa)

9.25

Isoelectric Point (pI)

33.08

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Mg_trans_NIPA PF05653 21 - 69 3.6e-16 Magnesium transporter NIPA
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0024861)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0163331
rosa_roxburghii Rroxscaffold_1G00030020
rosa_samantha Rh5AG335500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflIII ACRYGT 1 cut(s) 167
AgsI TTSAA 1 cut(s) 37
AjnI CCWGG 1 cut(s) 60
Alw26I GTCTC 1 cut(s) 131
AspA2I CCTAGG 1 cut(s) 82
AvrII CCTAGG 1 cut(s) 82
BciT130I CCWGG 1 cut(s) 62
BcoDI GTCTC 1 cut(s) 131
BfaI CTAG 1 cut(s) 83
BlnI CCTAGG 1 cut(s) 82
Bme1390I CCNGG 1 cut(s) 62
BmrFI CCNGG 1 cut(s) 62
BmsI GCATC 1 cut(s) 24
Bpu10I CCTNAGC 1 cut(s) 240
BsaJI CCNNGG 1 cut(s) 82
BseBI CCWGG 1 cut(s) 62
BseDI CCNNGG 1 cut(s) 82
BseGI GGATG 1 cut(s) 15
BseMII CTCAG 2 cut(s) 194, 231
BsmAI GTCTC 1 cut(s) 131
BspCNI CTCAG 2 cut(s) 193, 232
BssECI CCNNGG 1 cut(s) 82
BssT1I CCWWGG 1 cut(s) 82
Bst2UI CCWGG 1 cut(s) 62
BstC8I GCNNGC 1 cut(s) 246
BstDEI CTNAG 2 cut(s) 180, 240
BstF5I GGATG 1 cut(s) 15
BstMAI GTCTC 1 cut(s) 131
BstNI CCWGG 1 cut(s) 62
BstNSI RCATGY 1 cut(s) 171
BstSCI CCNGG 1 cut(s) 60
BstXI CCANNNNNNTGG 1 cut(s) 141
BtsCI GGATG 1 cut(s) 15
Cac8I GCNNGC 1 cut(s) 246
CsiI ACCWGGT 1 cut(s) 60
CviAII CATG 2 cut(s) 141, 168
CviJI RGCY 3 cut(s) 80, 238, 248
CviKI_1 RGCY 3 cut(s) 80, 238, 248
DdeI CTNAG 2 cut(s) 180, 240
Eco130I CCWWGG 1 cut(s) 82
EcoRII CCWGG 1 cut(s) 60
EcoT14I CCWWGG 1 cut(s) 82
ErhI CCWWGG 1 cut(s) 82
FaeI CATG 2 cut(s) 144, 171
FaiI YATR 4 cut(s) 42, 49, 142, 169
FatI CATG 2 cut(s) 140, 167
FokI GGATG 1 cut(s) 2
FspBI CTAG 1 cut(s) 83
Hin1II CATG 2 cut(s) 144, 171
HinfI GANTC 1 cut(s) 118
Hpy188I TCNGA 2 cut(s) 183, 195
Hpy188III TCNNGA 3 cut(s) 24, 34, 134
HpyCH4V TGCA 1 cut(s) 4
HpyF3I CTNAG 2 cut(s) 180, 240
Hsp92II CATG 2 cut(s) 144, 171
LmnI GCTCC 1 cut(s) 12
LpnPI CCDG 6 cut(s) 47, 74, 147, 198, 222, 230
LweI GCATC 1 cut(s) 24
MabI ACCWGGT 1 cut(s) 60
MaeI CTAG 1 cut(s) 83
MaeIII GTNAC 2 cut(s) 160, 202
MluCI AATT 1 cut(s) 98
MnlI CCTC 1 cut(s) 103
MseI TTAA 4 cut(s) 75, 101, 125, 250
MslI CAYNNNNRTG 1 cut(s) 182
MspR9I CCNGG 1 cut(s) 62
MvaI CCWGG 1 cut(s) 62
NlaIII CATG 2 cut(s) 144, 171
NspI RCATGY 1 cut(s) 171
PciI ACATGT 1 cut(s) 167
PfeI GAWTC 1 cut(s) 118
PscI ACATGT 1 cut(s) 167
Psp6I CCWGG 1 cut(s) 60
PspGI CCWGG 1 cut(s) 60
RseI CAYNNNNRTG 1 cut(s) 182
SaqAI TTAA 4 cut(s) 75, 101, 125, 250
ScrFI CCNGG 1 cut(s) 62
SetI ASST 2 cut(s) 66, 204
SexAI ACCWGGT 1 cut(s) 60
SfaNI GCATC 1 cut(s) 24
SmiMI CAYNNNNRTG 1 cut(s) 182
Sse9I AATT 1 cut(s) 98
SspMI CTAG 1 cut(s) 83
StyD4I CCNGG 1 cut(s) 60
StyI CCWWGG 1 cut(s) 82
TasI AATT 1 cut(s) 98
TfiI GAWTC 1 cut(s) 118
Tru1I TTAA 4 cut(s) 75, 101, 125, 250
Tru9I TTAA 4 cut(s) 75, 101, 125, 250
TspDTI ATGAA 1 cut(s) 200
XceI RCATGY 1 cut(s) 171
XmaJI CCTAGG 1 cut(s) 82
XspI CTAG 1 cut(s) 83
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.