RchiOBHm_Chr1g0328691

divergent subfamily of APPLE domains

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
18085865 .. 18086617
753 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 753 bp
ATGATTCATGATACAACCTTATGTATCAATGAAAGTTCAGTTCGTTCACATTTCAATATTTTCCGACTTTGGAAGAGTGAAGAATATGGCAACTTCATTAGTTCTGATGAGATGGCTTCTGCAATTCTCTACTTGCTATCAAACTTCACCTCTACAGCAGTCCACAATGACTCTGTGCCATATCTCACCTCCTCATTATACACTTCTATATGGCTGGTTATGAGTTTTTCGGGCCAGATTCAGTATCGGATGTGGGATAGTGAGAAGGTTTGGTCTTTGATATGTGCAGATCCTAGAGATAGATGTAGTGTGTATAATGCATGTGGAAATTTTGGTAGCTGTAACAGCAAAAATGGTTTGGTCTGCAAGTGTTTGCCTGGTTTTAAGCCTAGTTCACCTGATAATTGGAATCATGGAGATTATTCAGGCGGATGCACTAGGAAGTCAACATTATGTGACAACAATGCTGAGAGTGACACATTCTTGAGCTTAAAGATGATGAAAGTGGGAAACCCAGATTCCCAATTTAATGCCAAAAGTGAAGTGGAATGCAGAGTAGAGTGCCTTAACAACTGTGTGTGTCAAGCTTATGTCTATGAAGAGGTGGAGAACAAAAAAACGGGTGGGAGTAGTAATTCAACATGTTGGATTTGGTCACAAGATGTCACCAATCTTCAGGAGGACTATGACGGTGGCCAGAATCTACAGGTTCGTGTAGCAGTTTCAGATATAGGTATGTTTCTTTTTCTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

250

Amino Acids

28.1

Weight (kDa)

4.9

Isoelectric Point (pI)

44.26

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
S_locus_glycop PF00954 31 - 131 3.2e-21 S-locus glycoprotein domain
PAN_2 PF08276 152 - 224 2.8e-11 PAN-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019838)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 429
AclWI GGATC 1 cut(s) 284
AcoI YGGCCR 1 cut(s) 694
AcsI RAATTY 1 cut(s) 328
AcuI CTGAAG 1 cut(s) 659
AflIII ACRYGT 1 cut(s) 641
AgsI TTSAA 2 cut(s) 55, 639
AjnI CCWGG 1 cut(s) 376
AluBI AGCT 3 cut(s) 339, 489, 587
AluI AGCT 3 cut(s) 339, 489, 587
AlwI GGATC 1 cut(s) 284
AoxI GGCC 2 cut(s) 232, 694
ApoI RAATTY 1 cut(s) 328
AspS9I GGNCC 1 cut(s) 232
AsuHPI GGTGA 4 cut(s) 139, 178, 387, 658
BalI TGGCCA 1 cut(s) 696
BccI CCATC 1 cut(s) 106
BciT130I CCWGG 1 cut(s) 378
BfaI CTAG 3 cut(s) 294, 390, 438
BfmI CTRYAG 2 cut(s) 153, 704
Bme1390I CCNGG 1 cut(s) 378
BmgT120I GGNCC 1 cut(s) 232
BmrFI CCNGG 1 cut(s) 378
BmsI GCATC 1 cut(s) 422
BpuEI CTTGAG 1 cut(s) 505
BseBI CCWGG 1 cut(s) 378
BseGI GGATG 2 cut(s) 255, 437
BseMII CTCAG 1 cut(s) 459
BseRI GAGGAG 1 cut(s) 181
BsgI GTGCAG 1 cut(s) 306
BshFI GGCC 2 cut(s) 234, 696
BsmI GAATGC 1 cut(s) 554
BsnI GGCC 2 cut(s) 234, 696
Bsp143I GATC 1 cut(s) 289
BspACI CCGC 1 cut(s) 429
BspANI GGCC 2 cut(s) 234, 696
BspCNI CTCAG 1 cut(s) 460
BspHI TCATGA 1 cut(s) 7
BspPI GGATC 1 cut(s) 284
BssMI GATC 1 cut(s) 289
Bst2UI CCWGG 1 cut(s) 378
Bst4CI ACNGT 2 cut(s) 575, 692
Bst6I CTCTTC 2 cut(s) 68, 594
BstDEI CTNAG 1 cut(s) 468
BstF5I GGATG 2 cut(s) 255, 437
BstKTI GATC 1 cut(s) 292
BstMBI GATC 1 cut(s) 289
BstMWI GCNNNNNNNGC 1 cut(s) 345
BstNI CCWGG 1 cut(s) 378
BstNSI RCATGY 2 cut(s) 324, 645
BstSCI CCNGG 1 cut(s) 376
BstSFI CTRYAG 2 cut(s) 153, 704
BstX2I RGATCY 1 cut(s) 289
BstYI RGATCY 1 cut(s) 289
BsuRI GGCC 2 cut(s) 234, 696
BtsCI GGATG 2 cut(s) 255, 437
CciI TCATGA 1 cut(s) 7
Cfr13I GGNCC 1 cut(s) 232
CviAII CATG 4 cut(s) 8, 321, 413, 642
CviJI RGCY 8 cut(s) 116, 214, 234, 339, 388, 489, 587, 696
CviKI_1 RGCY 8 cut(s) 116, 214, 234, 339, 388, 489, 587, 696
DdeI CTNAG 1 cut(s) 468
DpnI GATC 1 cut(s) 291
DpnII GATC 1 cut(s) 289
EaeI YGGCCR 1 cut(s) 694
Eam1104I CTCTTC 2 cut(s) 68, 594
EarI CTCTTC 2 cut(s) 68, 594
EciI GGCGGA 1 cut(s) 444
Eco57I CTGAAG 1 cut(s) 659
EcoRII CCWGG 1 cut(s) 376
EcoT22I ATGCAT 1 cut(s) 322
FaeI CATG 4 cut(s) 11, 324, 416, 645
FatI CATG 4 cut(s) 7, 320, 412, 641
FokI GGATG 2 cut(s) 262, 444
FspBI CTAG 3 cut(s) 294, 390, 438
HaeIII GGCC 2 cut(s) 234, 696
Hin1II CATG 4 cut(s) 11, 324, 416, 645
HincII GTYRAC 1 cut(s) 447
HindII GTYRAC 1 cut(s) 447
HindIII AAGCTT 1 cut(s) 585
HinfI GANTC 6 cut(s) 4, 170, 238, 409, 518, 700
HphI GGTGA 4 cut(s) 139, 178, 387, 658
Hpy166II GTNNAC 4 cut(s) 47, 163, 395, 447
Hpy188I TCNGA 4 cut(s) 65, 106, 249, 727
Hpy188III TCNNGA 3 cut(s) 8, 484, 677
Hpy8I GTNNAC 4 cut(s) 47, 163, 395, 447
HpyAV CCTTC 1 cut(s) 259
HpyCH4III ACNGT 2 cut(s) 575, 692
HpyCH4V TGCA 6 cut(s) 122, 287, 320, 366, 435, 552
HpyF10VI GCNNNNNNNGC 1 cut(s) 345
HpyF3I CTNAG 1 cut(s) 468
Hsp92II CATG 4 cut(s) 11, 324, 416, 645
Kzo9I GATC 1 cut(s) 289
LweI GCATC 1 cut(s) 422
MaeI CTAG 3 cut(s) 294, 390, 438
MaeIII GTNAC 5 cut(s) 341, 455, 473, 654, 664
MalI GATC 1 cut(s) 291
MboI GATC 1 cut(s) 289
MboII GAAGA 4 cut(s) 85, 92, 611, 665
MflI RGATCY 1 cut(s) 289
MlsI TGGCCA 1 cut(s) 696
MluCI AATT 5 cut(s) 123, 328, 403, 524, 634
MluNI TGGCCA 1 cut(s) 696
MlyI GAGTC 1 cut(s) 164
MmeI TCCRAC 2 cut(s) 88, 626
MnlI CCTC 5 cut(s) 160, 199, 202, 595, 673
Mox20I TGGCCA 1 cut(s) 696
Mph1103I ATGCAT 1 cut(s) 322
MscI TGGCCA 1 cut(s) 696
MseI TTAA 5 cut(s) 384, 491, 528, 567, 751
Msp20I TGGCCA 1 cut(s) 696
MspR9I CCNGG 1 cut(s) 378
Mva1269I GAATGC 1 cut(s) 554
MvaI CCWGG 1 cut(s) 378
MwoI GCNNNNNNNGC 1 cut(s) 345
NdeII GATC 1 cut(s) 289
NlaIII CATG 4 cut(s) 11, 324, 416, 645
NmuCI GTSAC 4 cut(s) 455, 473, 654, 664
NsiI ATGCAT 1 cut(s) 322
NspI RCATGY 2 cut(s) 324, 645
PagI TCATGA 1 cut(s) 7
PciI ACATGT 1 cut(s) 641
PctI GAATGC 1 cut(s) 554
PfeI GAWTC 5 cut(s) 4, 238, 409, 518, 700
PleI GAGTC 1 cut(s) 164
PpsI GAGTC 1 cut(s) 164
PscI ACATGT 1 cut(s) 641
Psp6I CCWGG 1 cut(s) 376
PspGI CCWGG 1 cut(s) 376
PspPI GGNCC 1 cut(s) 232
PsuI RGATCY 1 cut(s) 289
SaqAI TTAA 5 cut(s) 384, 491, 528, 567, 751
Sau3AI GATC 1 cut(s) 289
Sau96I GGNCC 1 cut(s) 232
SchI GAGTC 1 cut(s) 164
ScrFI CCNGG 1 cut(s) 378
SfaNI GCATC 1 cut(s) 422
SfcI CTRYAG 2 cut(s) 153, 704
SmlI CTYRAG 1 cut(s) 484
SmoI CTYRAG 1 cut(s) 484
Sse9I AATT 5 cut(s) 123, 328, 403, 524, 634
SsiI CCGC 1 cut(s) 429
SspI AATATT 1 cut(s) 58
SspMI CTAG 3 cut(s) 294, 390, 438
StyD4I CCNGG 1 cut(s) 376
TaaI ACNGT 2 cut(s) 575, 692
TasI AATT 5 cut(s) 123, 328, 403, 524, 634
TfiI GAWTC 5 cut(s) 4, 238, 409, 518, 700
Tru1I TTAA 5 cut(s) 384, 491, 528, 567, 751
Tru9I TTAA 5 cut(s) 384, 491, 528, 567, 751
TseFI GTSAC 4 cut(s) 455, 473, 654, 664
Tsp45I GTSAC 4 cut(s) 455, 473, 654, 664
TspDTI ATGAA 4 cut(s) 45, 85, 515, 612
XapI RAATTY 1 cut(s) 328
XceI RCATGY 2 cut(s) 324, 645
XcmI CCANNNNNNNNNTGG 1 cut(s) 541
XspI CTAG 3 cut(s) 294, 390, 438
Zsp2I ATGCAT 1 cut(s) 322
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.