RchiOBHm_Chr1g0333451

Dephospho-CoA kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
25568659 .. 25573595
4937 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 186 bp
ATGTTGAGGGACAGAATAAGTGAGAATGATGCTCAAAAACGGATAAATGCTCAGGTGTCACTCGATTTAAAGAGGACCATGGCAGACATAGTGATTGATAACAGTGGATCACAAGATGATTTAAAAGACAACTTTAAAATTGTGCTATTTGAGGTCACAAAGCCCTTGACATGGACTGAACTTTAG

Protein Analysis

61

Amino Acids

7.05

Weight (kDa)

4.85

Isoelectric Point (pI)

15.03

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CoaE PF01121 1 - 39 1.4e-06 Dephospho-CoA kinase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029629)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0333451
rosa_roxburghii Rroxscaffold_4G00317490

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 115
AfiI CCNNNNNNNGG 1 cut(s) 171
AlwI GGATC 1 cut(s) 115
AspS9I GGNCC 1 cut(s) 75
AvaII GGWCC 1 cut(s) 75
Bme18I GGWCC 1 cut(s) 75
BmgT120I GGNCC 1 cut(s) 75
BmsI GCATC 1 cut(s) 19
Bpu10I CCTNAGC 1 cut(s) 51
BsaJI CCNNGG 1 cut(s) 78
Bsc4I CCNNNNNNNGG 1 cut(s) 171
BseDI CCNNGG 1 cut(s) 78
BseLI CCNNNNNNNGG 1 cut(s) 171
BseMII CTCAG 1 cut(s) 65
BslFI GGGAC 1 cut(s) 23
BslI CCNNNNNNNGG 1 cut(s) 171
BsmFI GGGAC 1 cut(s) 23
Bsp143I GATC 1 cut(s) 107
Bsp19I CCATGG 1 cut(s) 78
BspCNI CTCAG 1 cut(s) 64
BspPI GGATC 1 cut(s) 115
BssECI CCNNGG 1 cut(s) 78
BssMI GATC 1 cut(s) 107
BssT1I CCWWGG 1 cut(s) 78
Bst4CI ACNGT 1 cut(s) 104
BstDEI CTNAG 1 cut(s) 51
BstDSI CCRYGG 1 cut(s) 78
BstKTI GATC 1 cut(s) 110
BstMBI GATC 1 cut(s) 107
BtgI CCRYGG 1 cut(s) 78
BtsIMutI CAGTG 1 cut(s) 109
Cfr13I GGNCC 1 cut(s) 75
CviAII CATG 2 cut(s) 79, 171
CviJI RGCY 1 cut(s) 163
CviKI_1 RGCY 1 cut(s) 163
DdeI CTNAG 1 cut(s) 51
DpnI GATC 1 cut(s) 109
DpnII GATC 1 cut(s) 107
DraI TTTAAA 3 cut(s) 69, 123, 136
Eco130I CCWWGG 1 cut(s) 78
Eco47I GGWCC 1 cut(s) 75
EcoT14I CCWWGG 1 cut(s) 78
ErhI CCWWGG 1 cut(s) 78
FaeI CATG 2 cut(s) 82, 174
FaiI YATR 3 cut(s) 80, 89, 172
FaqI GGGAC 1 cut(s) 23
FatI CATG 2 cut(s) 78, 170
Hin1II CATG 2 cut(s) 82, 174
HpyCH4III ACNGT 1 cut(s) 104
HpyF3I CTNAG 1 cut(s) 51
Hsp92II CATG 2 cut(s) 82, 174
Kzo9I GATC 1 cut(s) 107
LpnPI CCDG 1 cut(s) 38
LweI GCATC 1 cut(s) 19
MaeIII GTNAC 2 cut(s) 57, 154
MalI GATC 1 cut(s) 109
MboI GATC 1 cut(s) 107
MluCI AATT 1 cut(s) 138
MnlI CCTC 2 cut(s) 66, 145
MseI TTAA 3 cut(s) 68, 122, 135
NcoI CCATGG 1 cut(s) 78
NdeII GATC 1 cut(s) 107
NlaIII CATG 2 cut(s) 82, 174
NmuCI GTSAC 2 cut(s) 57, 154
PspPI GGNCC 1 cut(s) 75
SaqAI TTAA 3 cut(s) 68, 122, 135
Sau3AI GATC 1 cut(s) 107
Sau96I GGNCC 1 cut(s) 75
SetI ASST 2 cut(s) 57, 156
SfaNI GCATC 1 cut(s) 19
SgeI CNNG 5 cut(s) 65, 74, 91, 125, 178
SinI GGWCC 1 cut(s) 75
Sse9I AATT 1 cut(s) 138
StyI CCWWGG 1 cut(s) 78
TaaI ACNGT 1 cut(s) 104
TaqI TCGA 1 cut(s) 63
TasI AATT 1 cut(s) 138
Tru1I TTAA 3 cut(s) 68, 122, 135
Tru9I TTAA 3 cut(s) 68, 122, 135
TscAI CASTG 1 cut(s) 109
TseFI GTSAC 2 cut(s) 57, 154
Tsp45I GTSAC 2 cut(s) 57, 154
TspGWI ACGGA 1 cut(s) 55
TspRI CASTG 1 cut(s) 109
VpaK11BI GGWCC 1 cut(s) 75
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.