RchiOBHm_Chr1g0348111

Catalyzes the radical-mediated insertion of two sulfur atoms into the C-6 and C-8 positions of the octanoyl moiety bound to the lipoyl domains of lipoate-dependent enzymes, thereby converting the octanoylated domains into lipoylated derivatives

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
40897308 .. 40897660
353 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 264 bp
ATGATTCTCGGCGACACATGTATGCATAGTTGCAATGTGAAGACTTCTAGAAATTCGCCGAGGCCAGACCCCAATAAGCGGGCGAATGTGGCTGAGGTAATTGCGTCGTGGGGGTTGGATTATGTGGTGATTACTAGCGTAGAACGAAATGATATGCCTGATCGAGGGAGTGGACATTTTGCTGAGATCGTGATCAAGTTGAAGAAGCTCAAACCTAATATGCTCATTAAGGCTTTAAGTATGTTTTCACTTTCGAGTAGCTGA

Protein Analysis

87

Amino Acids

9.62

Weight (kDa)

9.39

Isoelectric Point (pI)

40.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024784)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0348111
rosa_samantha Rh1BG175900 Rh1DG205700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 79
AcsI RAATTY 1 cut(s) 52
AfiI CCNNNNNNNGG 2 cut(s) 78, 164
AflIII ACRYGT 1 cut(s) 17
AgsI TTSAA 1 cut(s) 202
AluBI AGCT 2 cut(s) 208, 261
AluI AGCT 2 cut(s) 208, 261
AoxI GGCC 1 cut(s) 62
ApoI RAATTY 1 cut(s) 52
AsuHPI GGTGA 1 cut(s) 139
BbsI GAAGAC 1 cut(s) 47
BbvCI CCTCAGC 1 cut(s) 93
BclI TGATCA 1 cut(s) 192
BfaI CTAG 2 cut(s) 48, 135
BpiI GAAGAC 1 cut(s) 47
Bpu10I CCTNAGC 1 cut(s) 93
BsaBI GATNNNNATC 1 cut(s) 191
BsaJI CCNNGG 1 cut(s) 59
Bsc4I CCNNNNNNNGG 2 cut(s) 78, 164
Bse3DI GCAATG 1 cut(s) 40
Bse8I GATNNNNATC 1 cut(s) 191
BseDI CCNNGG 1 cut(s) 59
BseJI GATNNNNATC 1 cut(s) 191
BseLI CCNNNNNNNGG 2 cut(s) 78, 164
BseMI GCAATG 1 cut(s) 40
BseMII CTCAG 2 cut(s) 84, 174
BshFI GGCC 1 cut(s) 64
BslI CCNNNNNNNGG 2 cut(s) 78, 164
BsnI GGCC 1 cut(s) 64
Bsp143I GATC 3 cut(s) 160, 186, 192
BspACI CCGC 1 cut(s) 79
BspANI GGCC 1 cut(s) 64
BspCNI CTCAG 2 cut(s) 85, 175
BsrDI GCAATG 1 cut(s) 40
BssECI CCNNGG 1 cut(s) 59
BssMI GATC 3 cut(s) 160, 186, 192
BstC8I GCNNGC 1 cut(s) 81
BstDEI CTNAG 2 cut(s) 93, 183
BstENI CCTNNNNNAGG 1 cut(s) 162
BstKTI GATC 3 cut(s) 163, 189, 195
BstMBI GATC 3 cut(s) 160, 186, 192
BstMWI GCNNNNNNNGC 1 cut(s) 89
BstNSI RCATGY 1 cut(s) 21
BstV2I GAAGAC 1 cut(s) 47
BsuRI GGCC 1 cut(s) 64
Cac8I GCNNGC 1 cut(s) 81
CseI GACGC 1 cut(s) 93
CviAII CATG 1 cut(s) 18
CviJI RGCY 5 cut(s) 64, 92, 208, 233, 261
CviKI_1 RGCY 5 cut(s) 64, 92, 208, 233, 261
DdeI CTNAG 2 cut(s) 93, 183
DpnI GATC 3 cut(s) 162, 188, 194
DpnII GATC 3 cut(s) 160, 186, 192
EcoNI CCTNNNNNAGG 1 cut(s) 162
EcoT22I ATGCAT 1 cut(s) 27
FaeI CATG 1 cut(s) 21
FaiI YATR 7 cut(s) 19, 23, 27, 123, 155, 221, 242
FatI CATG 1 cut(s) 17
FauI CCCGC 1 cut(s) 72
FbaI TGATCA 1 cut(s) 192
FspBI CTAG 2 cut(s) 48, 135
HaeIII GGCC 1 cut(s) 64
HgaI GACGC 1 cut(s) 93
Hin1II CATG 1 cut(s) 21
HinfI GANTC 1 cut(s) 4
HphI GGTGA 1 cut(s) 139
Hpy166II GTNNAC 1 cut(s) 173
Hpy188III TCNNGA 2 cut(s) 48, 190
Hpy8I GTNNAC 1 cut(s) 173
Hpy99I CGWCG 1 cut(s) 109
HpyCH4V TGCA 2 cut(s) 25, 33
HpyF10VI GCNNNNNNNGC 1 cut(s) 89
HpyF3I CTNAG 2 cut(s) 93, 183
Hsp92II CATG 1 cut(s) 21
Ksp22I TGATCA 1 cut(s) 192
Kzo9I GATC 3 cut(s) 160, 186, 192
LpnPI CCDG 2 cut(s) 78, 171
MaeI CTAG 2 cut(s) 48, 135
MalI GATC 3 cut(s) 162, 188, 194
MboI GATC 3 cut(s) 160, 186, 192
MboII GAAGA 2 cut(s) 52, 214
MluCI AATT 2 cut(s) 52, 99
MmeI TCCRAC 1 cut(s) 96
MnlI CCTC 3 cut(s) 54, 88, 158
Mph1103I ATGCAT 1 cut(s) 27
MseI TTAA 2 cut(s) 228, 236
MslI CAYNNNNRTG 1 cut(s) 20
MwoI GCNNNNNNNGC 1 cut(s) 89
NdeII GATC 3 cut(s) 160, 186, 192
NlaIII CATG 1 cut(s) 21
NmeAIII GCCGAG 1 cut(s) 84
NsiI ATGCAT 1 cut(s) 27
NspI RCATGY 1 cut(s) 21
PciI ACATGT 1 cut(s) 17
PfeI GAWTC 1 cut(s) 4
PscI ACATGT 1 cut(s) 17
RseI CAYNNNNRTG 1 cut(s) 20
SaqAI TTAA 2 cut(s) 228, 236
Sau3AI GATC 3 cut(s) 160, 186, 192
SetI ASST 4 cut(s) 99, 210, 217, 263
SmiMI CAYNNNNRTG 1 cut(s) 20
Sse9I AATT 2 cut(s) 52, 99
SsiI CCGC 1 cut(s) 79
SspMI CTAG 2 cut(s) 48, 135
TaqI TCGA 2 cut(s) 163, 254
TasI AATT 2 cut(s) 52, 99
TfiI GAWTC 1 cut(s) 4
Tru1I TTAA 2 cut(s) 228, 236
Tru9I TTAA 2 cut(s) 228, 236
XagI CCTNNNNNAGG 1 cut(s) 162
XapI RAATTY 1 cut(s) 52
XbaI TCTAGA 1 cut(s) 47
XceI RCATGY 1 cut(s) 21
XspI CTAG 2 cut(s) 48, 135
Zsp2I ATGCAT 1 cut(s) 27
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.