RchiOBHm_Chr1g0369891

Clathrin is the major protein of the polyhedral coat of coated pits and vesicles

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
59544051 .. 59548373
4323 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 216 bp
ATGTTTAGGCAGAATGCAATTCAGCTCGCAGAGAAGGAGAAGAGCGAAAAGGAGCTTTTGAGCCAAATCATCGGAGAAGCTGAAGATTTCAAGGTTGAATTTTATCAGAAGAGGAAGATCACTTCTGAGAATAACAAAGCTACTAACAGGGAAAAAGAGAAGATGTTTGTTGCCAGTCAAGAGAAGTTTCATGCTGAGGTAGACAAGAACTACTAG

Protein Analysis

71

Amino Acids

8.47

Weight (kDa)

6.59

Isoelectric Point (pI)

33.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024434)

Species Orthologous Gene IDs
malus_domestica MD17G1243100.v1.1
rosa_chinensis RchiOBHm_Chr1g0369891
rosa_samantha Rh1AG361600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 201
AcsI RAATTY 1 cut(s) 98
AcuI CTGAAG 1 cut(s) 102
AgsI TTSAA 2 cut(s) 91, 98
AluBI AGCT 4 cut(s) 25, 55, 80, 140
AluI AGCT 4 cut(s) 25, 55, 80, 140
ApoI RAATTY 1 cut(s) 98
BbvCI CCTCAGC 1 cut(s) 195
BfaI CTAG 1 cut(s) 214
Bpu10I CCTNAGC 1 cut(s) 195
Bse1I ACTGG 1 cut(s) 174
BseMII CTCAG 2 cut(s) 117, 186
BseNI ACTGG 1 cut(s) 174
BsmI GAATGC 1 cut(s) 19
Bsp143I GATC 1 cut(s) 117
BspCNI CTCAG 2 cut(s) 118, 187
BspQI GCTCTTC 1 cut(s) 35
BsrI ACTGG 1 cut(s) 174
BssMI GATC 1 cut(s) 117
Bst6I CTCTTC 2 cut(s) 35, 104
BstC8I GCNNGC 1 cut(s) 27
BstDEI CTNAG 2 cut(s) 126, 195
BstKTI GATC 1 cut(s) 120
BstMBI GATC 1 cut(s) 117
Cac8I GCNNGC 1 cut(s) 27
CviAII CATG 1 cut(s) 191
CviJI RGCY 5 cut(s) 25, 55, 63, 80, 140
CviKI_1 RGCY 5 cut(s) 25, 55, 63, 80, 140
DdeI CTNAG 2 cut(s) 126, 195
DpnI GATC 1 cut(s) 119
DpnII GATC 1 cut(s) 117
Eam1104I CTCTTC 2 cut(s) 35, 104
EarI CTCTTC 2 cut(s) 35, 104
Eco57I CTGAAG 1 cut(s) 102
FaeI CATG 1 cut(s) 194
FaiI YATR 1 cut(s) 192
FatI CATG 1 cut(s) 190
FblI GTMKAC 1 cut(s) 201
FspBI CTAG 1 cut(s) 214
Hin1II CATG 1 cut(s) 194
Hpy166II GTNNAC 1 cut(s) 202
Hpy188I TCNGA 3 cut(s) 74, 108, 127
Hpy188III TCNNGA 1 cut(s) 179
Hpy8I GTNNAC 1 cut(s) 202
HpyAV CCTTC 1 cut(s) 28
HpyCH4V TGCA 1 cut(s) 17
HpyF3I CTNAG 2 cut(s) 126, 195
Hsp92II CATG 1 cut(s) 194
Kzo9I GATC 1 cut(s) 117
LguI GCTCTTC 1 cut(s) 35
LmnI GCTCC 1 cut(s) 52
LpnPI CCDG 2 cut(s) 133, 187
MaeI CTAG 1 cut(s) 214
MalI GATC 1 cut(s) 119
MboI GATC 1 cut(s) 117
MboII GAAGA 5 cut(s) 52, 95, 121, 127, 172
MluCI AATT 2 cut(s) 18, 98
MnlI CCTC 2 cut(s) 105, 190
Mva1269I GAATGC 1 cut(s) 19
NdeII GATC 1 cut(s) 117
NlaIII CATG 1 cut(s) 194
PciSI GCTCTTC 1 cut(s) 35
PctI GAATGC 1 cut(s) 19
SapI GCTCTTC 1 cut(s) 35
Sau3AI GATC 1 cut(s) 117
SetI ASST 6 cut(s) 27, 57, 82, 96, 142, 201
SgeI CNNG 6 cut(s) 38, 103, 160, 186, 191, 203
Sse9I AATT 2 cut(s) 18, 98
SspMI CTAG 1 cut(s) 214
TasI AATT 2 cut(s) 18, 98
TspDTI ATGAA 1 cut(s) 179
XapI RAATTY 1 cut(s) 98
XmiI GTMKAC 1 cut(s) 201
XspI CTAG 1 cut(s) 214
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.