RCHIOBHM_CHR0C11G0499421

Belongs to the ubiquitin-conjugating enzyme family

Basic Information

Type: Sequence Only
Biological Identity
rosa_chinensis
Unknown
Physical Location & Seq
Reverse (-)
0 .. 0
1 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 198 bp
ATGTATGAAATTAAAATTACTGGAGGTCAGCAGATCGTATTCAGGACTCTAGTCTTCCATTGCAATGTTGATTCTTCTGGTAATGTAAGTTTGGAAATCGTAAAGGATGGTTGGAGTCCAGCTCCAACGATTACAAAGGTGCTACTAGTAATTCGGTCCATTTTCACAAAACCTGATCCTTTGCCAGCAAGTGCTTAA

Protein Analysis

65

Amino Acids

7.1

Weight (kDa)

7.92

Isoelectric Point (pI)

42.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029502)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr0c11g0499421 RchiOBHm_Chr4g0433661

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 170
AhlI ACTAGT 1 cut(s) 145
AluBI AGCT 1 cut(s) 122
AluI AGCT 1 cut(s) 122
AlwI GGATC 1 cut(s) 170
AspS9I GGNCC 1 cut(s) 156
AvaII GGWCC 1 cut(s) 156
BbsI GAAGAC 1 cut(s) 46
BccI CCATC 1 cut(s) 101
BcuI ACTAGT 1 cut(s) 145
BfaI CTAG 2 cut(s) 50, 146
Bme18I GGWCC 1 cut(s) 156
BmgT120I GGNCC 1 cut(s) 156
BoxI GACNNNNGTC 1 cut(s) 50
BpiI GAAGAC 1 cut(s) 46
BplI GAGNNNNNCTC 2 cut(s) 106, 138
BpmI CTGGAG 1 cut(s) 42
Bse1I ACTGG 1 cut(s) 25
Bse3DI GCAATG 2 cut(s) 58, 70
BseGI GGATG 1 cut(s) 112
BseMI GCAATG 2 cut(s) 58, 70
BseNI ACTGG 1 cut(s) 25
Bsp143I GATC 2 cut(s) 33, 175
BspPI GGATC 1 cut(s) 170
BsrDI GCAATG 2 cut(s) 58, 70
BsrI ACTGG 1 cut(s) 25
BssMI GATC 2 cut(s) 33, 175
BstC8I GCNNGC 1 cut(s) 186
BstF5I GGATG 1 cut(s) 112
BstKTI GATC 2 cut(s) 36, 178
BstMBI GATC 2 cut(s) 33, 175
BstPAI GACNNNNGTC 1 cut(s) 50
BstV2I GAAGAC 1 cut(s) 46
BtsCI GGATG 1 cut(s) 112
Cac8I GCNNGC 1 cut(s) 186
Cfr13I GGNCC 1 cut(s) 156
CviJI RGCY 1 cut(s) 122
CviKI_1 RGCY 1 cut(s) 122
DpnI GATC 2 cut(s) 35, 177
DpnII GATC 2 cut(s) 33, 175
Eco47I GGWCC 1 cut(s) 156
FaiI YATR 1 cut(s) 6
FokI GGATG 1 cut(s) 119
FspBI CTAG 2 cut(s) 50, 146
GsuI CTGGAG 1 cut(s) 42
HinfI GANTC 3 cut(s) 46, 71, 115
Hpy188III TCNNGA 1 cut(s) 43
HpyCH4V TGCA 1 cut(s) 63
Kzo9I GATC 2 cut(s) 33, 175
LmnI GCTCC 1 cut(s) 127
LpnPI CCDG 5 cut(s) 6, 28, 63, 132, 186
MaeI CTAG 2 cut(s) 50, 146
MalI GATC 2 cut(s) 35, 177
MboI GATC 2 cut(s) 33, 175
MboII GAAGA 2 cut(s) 46, 66
MluCI AATT 3 cut(s) 9, 15, 150
MlyI GAGTC 2 cut(s) 40, 124
MmeI TCCRAC 2 cut(s) 92, 149
MnlI CCTC 1 cut(s) 17
MseI TTAA 2 cut(s) 12, 196
MslI CAYNNNNRTG 1 cut(s) 63
NdeII GATC 2 cut(s) 33, 175
PfeI GAWTC 1 cut(s) 71
PleI GAGTC 2 cut(s) 40, 123
PpsI GAGTC 2 cut(s) 40, 123
PshAI GACNNNNGTC 1 cut(s) 50
PspPI GGNCC 1 cut(s) 156
RseI CAYNNNNRTG 1 cut(s) 63
SaqAI TTAA 2 cut(s) 12, 196
Sau3AI GATC 2 cut(s) 33, 175
Sau96I GGNCC 1 cut(s) 156
SchI GAGTC 2 cut(s) 40, 124
SetI ASST 4 cut(s) 28, 124, 141, 175
SgeI CNNG 7 cut(s) 33, 55, 62, 90, 131, 158, 185
SinI GGWCC 1 cut(s) 156
SmiMI CAYNNNNRTG 1 cut(s) 63
SpeI ACTAGT 1 cut(s) 145
Sse9I AATT 3 cut(s) 9, 15, 150
SspMI CTAG 2 cut(s) 50, 146
TaqII GACCGA 1 cut(s) 144
TasI AATT 3 cut(s) 9, 15, 150
TfiI GAWTC 1 cut(s) 71
Tru1I TTAA 2 cut(s) 12, 196
Tru9I TTAA 2 cut(s) 12, 196
TspDTI ATGAA 1 cut(s) 21
VpaK11BI GGWCC 1 cut(s) 156
XspI CTAG 2 cut(s) 50, 146
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.